An in vitro model to assess effects of a desensitising agent on bacterial biofilm formation

Figures & data

Table 1. Forward and reverse sequences of the primers MKD and SobGTFI.

Primer	Forward sequence	Reverse sequence
MKD	GGCACCACAACATTGGGAAGCTCAGTT	GGAATGGCCGCTAAGTCAACAGGAT
SobGTFI	GATAACTACCTGACAGCTGACT	AAGCTGCCTTAAGGTAATCACT

Figure 1. Patent dentine tubules following etching of the dentine surface with 6% citric acid for 90 seconds.

Figure 2. SEM image of a CSPS plus fluoride treated sample following incubation showing occluded tubules and an altered surface layer.

Figure 3. SEM image of a pumice treated sample following intubation demonstrating the formation of an extracellular matrix (highlighted by arrow).

Figure 4. qPCR estimates for the number of S. mutans and S. sobrinus bacteria per a sample. Error Bars represent one standard deviation from the mean.

Figure 5. Colony forming units estimated on each sample as the number per a disc for S. mutans and S. sobrinus. Error bars represent one standard deviation from the mean.