Identification of α-isopropylmalate synthase mutants capable of overproducing L-leucine in Corynebacterium glutamicum

Figures & data

Figure 1. Biosynthesis of branched chain amino acids and its regulation in C. glutamicum. Feedback regulation by various amino acids is indicated by dashed double arrow. Repression regulation by various amino acids is indicated by solid double arrow.

Table 1. Strains, plasmids and primers used in this study.

	Genotype and/or description	Source
Strains
E. coli DH5α	E. coli host cell for propagating plasmid	Novagen
BL21 (DE3)	E. coli host cell for protein expression	Novagen
BL21 (DE3)/leuA^V	BL21 (DE3) harboring pET28a-leuA^V	This work
BL21 (DE3)/leuA	BL21 (DE3) harboring pET28a-leuA	This work
ATCC 13032	Wilde-type C. glutamicum	ATCC
ATCC 13032/leuA^V	ATCC 13032 harboring pXMJ19-leuA^V	This work
ATCC 13032/leuA	ATCC 13032 harboring pXMJ19-leuA	This work
ATCC 13032/ilvBN^V	ATCC 13032 harboring pXMJ19-ilvBN^V	This work
ATCC 13032/ilvBN^V-leuA^V	ATCC 13032 harboring pXMJ19-ilvBN^V-leuA^V	This work
ARTP-L04	L-leucine-producing strain (AHV^r AEC^r Eth^r α-AB^r Suc^g)	Our Lab
Plasmids
pET28a	Protein expression vector	Novagen
pET28a-leuA^V	pET28a harboring leuA^V	This work
pET28a-leuA	pET28a harboringleuA	This work
pXMJ19	Shuttle vector between E. coli and C. glutamicum	[Jakoby et al. 1999]
pXMJ19-leuA^V	pXMJ19 harboring leuA^V	This work
pXMJ19-leuA	pXMJ19 harboring leuA	This work
pXMJ19-ilvBN^V-leuA^V	pXMJ19 harboring ilvBN^V and leuA^V	This work
pUC19-ilvBN^V	pUC19 harboring ilvBN^V	This work
Primers	Nucleotide sequence (5′–3′)*	Restriction sites
leuA-F1	CCGGAATTCATGCCAGTTAACCGCTACAT	EcoR I
leuA-R1	CCGCTCGAGTTAAACGCCGCCAGCCAGG	Xho I
leuA-F2	CCGTCTAGAATGCCAGTTAACCGCTACAT	Xba I
leuA-R2	CCGGAATTCTTAAACGCCGCCAGCCAGG	EcoR I
ilvBN-F	CCCAAGCTTGTGAATGTGGCAGCTTCTCAAC	Hind III
ilvBN-R	GCTCTAGATTAGATCTTGGCCGGAGC	Xba I

Origin from strain ARTP-L04 was indicated with superscript V. *Underlined bases were the restriction enzyme sites. Genetic resistance was indicated with superscript r. Sole carbon was indicated with superscript g. AHV, α-amino-β-hydroxyvaleric acid. AEC, S-(2-aminoethyl) -L-cysteine. Eth, ethionine. α-AB, α-aminobutyric acid. Suc, succinic acid.

Figure 2. SDS-PAGE analysis of α-IPMS variant and wild-type α-IPMS. Lane M, molecular markers; lane CK, cell lysates of BL21 (DE3); lane C1, cell lysates of BL21 (DE3)/leuA; lane P1, purified protein of wild-type α-IPMS; lane C2, cell lysates of BL21 (DE3)/leuAV; lane P2, purified protein of α-IPMS variant.

Figure 3. Sequence alignment between α-IPMS variant and wild-type α-IPMS.

Table 2. Characterization of α-IPMS variant and wild-type α-IPMS.

	wild-type α-IPMS	α-IPMS variant
Km 2-ketoisovalerate (μM)	5.9 ± 0.17	6.1 ± 0.26
Km acetyl-CoA (μM)	8.9 ± 0.28	8.7 ± 0.43
IC50 (mM)	0.46 ± 0.02	>20

Figure 4. Relative activities of α-IPMS variant and wild-type α-IPMS at different concentrations of L-leucine. A, α-IPMS variant; B, wild-type α-IPMS.

Figure 5. Production of L-leucine in different recombinant strains. A, Strain ATCC 13032/leuA; B, Strain ATCC 13032/ilvBN^V; C, Strain ATCC 13032/leuA^V; D, Strain ATCC 13032/ilvBN^V-leuA^V.

Table 3. Production of L-leucine and L-valine in different recombination strains.

Strains	Description	L-leucine(g/L)	L-valine titer(g/L)
ATCC 13032	Wilde-type C. glutamicum	0	0
ATCC 13032/leuA	ATCC 13032 harboring pXMJ19-leuA	0.73 ± 0.018	0
ATCC 13032/leuA^V	ATCC 13032 harboring pXMJ19-leuA^V	2.34 ± 0.088	0
ATCC 13032/ilvBN^V	ATCC 13032 harboring pXMJ19-ilvBN	0.47 ± 0.014	2.53 ± 0.049
ATCC 13032/ilvBN^V-leuA^V	Harboring pXMJ19-ilvBN^V-leuA^V	7.8 ± 0.138	0.37 ± 0.014
ARTP-L04	L-leucine-producing strain	18 ± 0.192	0.41 ± 0.017

Jakoby M, Ngouoto-Nkili CE, Burkovski A. 1999. Construction and application of new Corynebacterium glutamicum vectors. Biotechnol Tech. 13:437–441.

 Google Scholar

Data availability statement

The authors confirm that raw data supporting the findings of this study are available at https://www.scidb.cn/anonymous/UXJlWWpp.