Annexin A1 is elevated in patients with COPD and affects lung fibroblast function

Figures & data

Table 1 Characteristics of the study subjects

Parameters	Nonsmokers without COPD (n=12)	Smokers without COPD (n=11)	Smokers with COPD (n=22)	p-value
Age, years	59.0±1.9	60.6±2.4	61.6±1.5	0.384
Male, n (%)	7 (58.3)	7 (63.6)	18 (81.8)	0.223
Smokers, former/current, n (%)	N/A	4 (36.4)/7 (63.6)	7 (31.8)/15 (68.2)	0.211
Smoking, pack-years	N/A	15.1±1.9	25.0±2.7	0.021
BMI, kg/m^2	23.2±0.5	24.6±0.8	23.1±0.8	0.470
FVC, L	3.15±0.23	3.15±0.12	2.83±0.20	0.041
FEV1, %Pred	104.7±4.28	87.44±3.57	56.82±4.25	<0.01
FEV1/FVC, %	87.54±2.49	81.56±1.82	54.06±2.23	<0.01
GOLD I and II/III and IV,* n (%)	N/A	N/A	11 (50)/11 (50)	–
Treatment regimens, n (%)	N/A	N/A		–
ICS/LABA			17 (77.3)
LAMA			6 (27.3)
SABA			15 (68.2)

Notes: Severity of COPD* was graded according to GOLD. GOLD I, mild, FEV₁% predicted ≥80%; GOLD II, moderate, 80% > FEV₁% predicted ≤50%; GOLD III, severe, 50% > FEV₁% predicted ≤30%; GOLD IV, very severe, FEV₁% predicted <30%. Data are presented as mean ± SEM or n (%), unless otherwise stated.

Abbreviations: BMI, body mass index; COPD, chronic obstructive pulmonary disease; FEV₁, forced expiratory volume in 1 second; FVC, forced vital capacity; GOLD, Global Initiative for Chronic Obstructive Lung Disease; ICS, inhaled corticosteroid; LABA, long-acting β agonist; LAMA, long-acting muscarinic agonist; SABA, short-acting β₂ agonist; N/A, not applicable.

Figure 1 Serum Annexin A1 levels were increased in patients with COPD.

Notes: (A and B) Amounts of Annexin A1 in the serum were quantified in study subjects (12 nonsmokers, 11 smokers, and 22 smokers with COPD) using ELISA. Levels of serum Annexin A1 were stratified according to smoking history and disease severity (GOLD stages). (C and D) Correlations between levels of serum Annexin A1 and forced expiratory volume in one second (FEV₁) predicted %, and pack-years were investigated using Spearman’s rank correlation. (E) Smoking history was stratified according to disease severity (GOLD stages). Data are presented as mean ± SEM.
Abbreviations: COPD, chronic obstructive pulmonary disease; ELISA, enzyme-linked immunosorbent assay; GOLD, Global Initiative for Chronic Obstructive Lung Disease.

Figure 2 Annexin A1 expression on HBE cells exposed to CSE.

Notes: (A and B) Real-time PCR was conducted to detect the mRNA expression of Annexin A1 in CSE-exposed HBE cells. (C and E) Western blots for Annexin A1 (D and F) Annexin A1 expression was analyzed using Quantity One (BioRad, Hercules, CA, USA) to quantify the protein expression. Data are from one experiment representative of three independent experiments. Data were presented as the mean ± SEM.
Abbreviations: CSE, cigarette smoke extract; HBE, human bronchial epithelial; PCR, polymerase chain reaction.

Figure 3 Effect of Annexin A1 on the migration and proliferation of human lung fibroblast cells.

Notes: (A) Representative images of human lung fibroblast cells treated with Annexin A1 or untreated, at time 0 and after 12 or 22 h of incubation are shown. Increased fibroblast migration was observed in Annexin A1-treated fibroblasts versus control fibroblasts. 400× magnification. (B) Results are expressed as percentage of recovered wound area; (C) Cells were treated with Annexin A1 for 48 h, and then cell proliferation was measured with a CCK-8 assay. Data are from three independent experiments. Data were presented as the mean ± SEM.

Figure 4 The effect of Annexin A1 on collagen synthesis in lung fibroblast cells.

Notes: Lung fibroblast cells were treated with 0–150 ng/mL Annexin A1 for 48 h. Collagen I and collagen III production were determined by immunofluorescence staining (A and D; 400× magnification), and Western blot analysis (B and E). Analysis by densitometry of immunodetection of collagen I and collagen III using ImageJ (C and F). Results were expressed as mean ± SEM of three independent experiments.

Figure 5 The effect of Annexin A1 treatment on α-SMA protein expression in lung fibroblast cells.

Notes: Measurements of α-SMA expression upon stimulation by Annexin A1 as determined by immunofluorescence staining (A; 400× magnification), and Western blot analysis (B), and analysis by densitometry of immunodetection of α-SMA (C). Results were expressed as mean ± SEM of three independent experiments.

Abbreviation: α-SMA, alpha-smooth muscle actin.

Figure 6 Annexin A1 induced cytokine mRNA expression in human lung fibroblast cells.

Notes: The expression of IL-6 (A), IL-8 (B), and IL-1β (C) in response to Annexin A1 treatment at 100 ng/mL for 3, 6, 9, and 12 h were analyzed by reverse transcription-polymerase chain reaction. Results were normalized by GAPDH and expressed as fold change in comparison with control value. Results were expressed as mean ± SEM of three independent experiments.

Figure 7 Annexin A1 induced phosphorylation of extracellular signal related kinase (ERK) and p38 in lung fibroblast cells.

Notes: (A and B) Recombinant human Annexin A1 protein activated ERK and p38 phosphorylation in a dose-dependent manner (0, 50, 100, and 150 ng/mL for 2 h). (C and D) Stimulation of lung fibroblast cells with 100 ng/mL recombinant human Annexin A1 protein induced phosphorylation of ERK and p38 in a time-dependent manner (0, 10, 30, 60, 90, and 120 min).

Figure S1 Annexin A1 expression were stratified according to smoking history in smokers with or without COPD. Levels of Annexin A1 were analyzed by ELISA. Data are presented as mean ± SEM.

Abbreviations: COPD, chronic obstructive pulmonary disease; ELISA, enzyme-linked immunosorbent assay.

Table S1 Primer sets for real-time polymerase chain reaction analysis

Genes	Forward	Reverse
Annexin A1 (human gene)	ATCAGCGGTGAGCCCCTATC	TTCATCCAGGGGCTTTCCTG
IL-6 (human gene)	CCTGAACCTTCCAAAGATGGC	TTCACCAGGCAAGTCTCCTCA
IL-8 (human gene)	ACTGAGAGTGATTGAGAGTGGAC	AACCCTCTGCACCCAGTTTTC
IL-1β (human gene)	CCAGGGACAGGTATGGAGCA	TTCAACACGCAGGACAGGTACAG
GAPDH (human gene)	TGTTGCCATCAATGACCCCTT	CTCCACGACGTACTCAGCG