Nucleosides isolated from Ophiocordyceps sinensis inhibit cigarette smoke extract-induced inflammation via the SIRT1–nuclear factor-κB/p65 pathway in RAW264.7 macrophages and in COPD mice

Figures & data

Table 1 Primer sets

Mouse	Forward primer	Reverse primer
SIRT1	CAGACCCTCAAGCCATGTTTGATA	TTGGATTCCTGCAACCTGCTC
TNF-α	CAACGCCCTCCTGGCCAACG	TCGGGGCAGCCTTGTCCCTT
IL-1β	GACAGTGATGAGAATGACCTG	TGGAAGGTCCACGGGAAAGAC
iNOS	AGCAACTACTGCTGGTGGTG	TCTTCAGAGTCTGCCCATTG
GAPDH	AATGTGTCCGTCGTGGATCT	CATCGAAGGTGGAAGAGTGG

Table 2 Retention times of unknown nucleosides and their concentrations in Ophiocordyceps sinensis

Nucleoside	1	2	3	4	5	6	7	8	9	10
C/µg/mg	0.25±0.01	0.06±0.003	4.12±0.19	3.7±0.17	2.7±0.12	7.9±0.36	2.9±0.13	0.74±0.03	9.2±0.42	0.77±0.03
tR/min	3.4	3.9	4.8	6.0	7.4	8.4	10.0	10.8	13.2	24.2

Notes: Unknown identification, 1, cytidine; 2, adenine; 3, guanine; 4, uracil; 5, hypoxanthine; 6, uridine; 7, adenosine; 8, 2′-deoxyadenosine; 9, guanosine; 10, thymidine.

Figure 1 Typical chromatograms of (A) nucleoside standards and (B) unknown peaks in C. sinensis determined by high-performance liquid chromatography.

Notes: Unknown nucleoside peaks in C. sinensis were tentatively identified as: 1, cytidine; 2, adenine; 3, guanine; 4, uracil; 5, hypoxanthine; 6, uridine; 7, adenosine; 8, 2′-deoxyadenosine; 9, guanosine; 10, thymidine.
Abbreviation: C. sinensis, Ophiocordyceps sinensis.

Figure 2 Effects of the isolated nucleosides on NO and iNOS expression in RAW264.7 cells.

Notes: The isolated nucleosides decreased (A) CSE-induced NO production, (B) iNOS mRNA expression, (C) iNOS protein, and (D) its quantitative level in RAW264.7 cells. **P<0.01, CSE-induced group vs control group (without any treatment); ^#P<0.05, ^##P<0.01, nucleoside treatment groups (25 and 50 µg/mL) vs CSE-induced group. All experiments were repeated three times. Data shown as mean ± SEM (n=3).
Abbreviations: CSE, cigarette smoke extract; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; iNOS, inducible nitric oxide synthase; NO, nitric oxide.

Figure 3 Effects of the nucleosides on CSE-induced TNF-α, IL-6, and IL-1β expression in RAW264.7 cells.

Notes: The nucleosides suppressed CSE-induced expression of (A) TNF-α, (B) IL-6, and (C) IL-1β, and (D) their mRNA expression in RAW264.7 cells. *P<0.05, **P<0.01, ***P<0.001, CSE-induced group vs control group (without any treatment); ^#P<0.05, ^##P<0.01, nucleoside treatment groups (25 and 50 µg/mL) vs CSE-induced group. All the experiments were repeated three times. Data shown as mean ± SEM (n=3).
Abbreviations: CSE, cigarette smoke extract; IL-1β, interleukin-1β; IL-6, interleukin-6; TNF-α, tumor necrosis factor-α.

Figure 4 Effects of the nucleosides on (A) mRNA, (B) Western blot, and (C) quantity of SIRT1, as well as (D) Western blot and (E) quantity of NF-κB/p65 in CSE-induced RAW264.7 cells.

Notes: **P<0.01, CSE-induced group vs control group (without any treatment); ^#P<0.05, ^##P<0.01, nucleoside treatment groups (25 and 50 µg/mL) vs CSE-induced group. All the experiments were repeated three times. Data shown as mean ± SEM (n=3).
Abbreviations: CSE, cigarette smoke extract; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; iNOS, inducible nitric oxide synthase; NF-κB, nuclear factor-κB; NO, nitric oxide; SIRT1, silent information regulator 1.

Figure 5 Impact of the SIRT1 antagonist EX527 on treatment effects of the nucleosides on the CSE-induced RAW264.7 cells.

Notes: (A) mRNA levels of SIRT1, TNF-α, IL-6, IL-1β, and iNOS; (B) Western blots of SIRT1, NF-κB/p65, and iNOS; (C) quantification histograms of SIRT1, NF-κB/p65, and iNOS. Study groups: 1, C: control, without any treatment; 2, CSE: CSE treatment; 3, CSE + N: CSE + nucleoside (50 µg/mL) treatment; 4, EX + CSE + N: EX527 (10 µM) + CSE + nucleosides (50 µg/mL) treatment; 5, EX + CSE: EX527 (10 µM) + CSE treatment; 6, EX: EX527 (10 µM) treatment. ^#P<0.05, CSE + N group vs CSE group; *P<0.05, C: CSE + EX + N group vs CSE + EX group.
Abbreviations: CSE, cigarette smoke extract; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL-1β, interleukin-1β; IL-6, interleukin-6; iNOS, inducible nitric oxide synthase; NF-κB, nuclear factor-κB; NO, nitric oxide; SIRT1, silent information regulator 1.

Figure 6 Effects of the nucleosides on (A) NO, (B) TNF-α, (C) IL-1β, and (D) inflammatory cells in CSE-induced mice.

Notes: Study groups: C: control, orally treated with the vehicle only; M: model, intraperitoneal injection of CSE; P: positive control, orally treated with budesonide (2 mg/kg) after CSE challenge; 20: nucleosides dosed at 20 mg/kg; 40: nucleosides dosed at 40 mg/kg. **P<0.01, ***P<0.001, model group vs control group; ^#P<0.05, ^##P<0.01, ###P<0.001, treatment group vs model group. Data shown as mean ± SEM (n=4, each group).
Abbreviations: BALF, bronchoalveolar lavage fluid; CSE, cigarette smoke extract; IL-1β, interleukin-1β; NO, nitric oxide; TNF-α, tumor necrosis factor-α.

Figure 7 Effects of the nucleosides on lung histological changes measured by H&E staining and the associated protein expression by immunohistochemistry and Western blot analysis.

Notes: (A) H&E staining analysis of the effect of nucleosides (100×) and immunohistochemistry analysis of SIRT1 and NF-κB/p65 expression (400×). (B) Western blot analysis of iNOS, SIRT1, and NF-κB/p65 expression in the CSE-stimulated mice. (C) Quantitative levels of (B). Study groups: C: control, orally treated with the vehicle only; M: model, intraperitoneal injection of CSE; P: positive control, orally treated with budesonide (2 mg/kg) after CSE challenge; 20: nucleosides dosed at 20 mg/kg; 40: nucleosides dosed at 40 mg/kg. *P<0.05, **P<0.01, model group vs control group; ^#P<0.05, treatment group vs model group. Data shown as mean ± SEM (n=4, each group).
Abbreviations: CSE, cigarette smoke extract; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; iNOS, inducible nitric oxide synthase; NF-κB, nuclear factor-κB; SIRT1, silent information regulator 1.

Figure 8 Proposed therapeutic mechanism of the nucleosides on cigarette smoke extract-induced inflammation via the SIRT1–NF-κB/p65 pathway.

Abbreviations: COPD, chronic obstructive pulmonary disease; IL-1β, interleukin-1β; IL-6, interleukin-6; NF-κB, nuclear factor-κB; NO, nitric oxide; SIRT1, silent information regulator 1; TNF-α, tumor necrosis factor-α.