Baicalein suppresses metastasis of breast cancer cells by inhibiting EMT via downregulation of SATB1 and Wnt/β-catenin pathway

Figures & data

Figure 1 Chemical structure of baicalein.

Table 1 Experimental grouping and treatment

Group	Treatment	Number of mice
Control	IGa with NS	6
Therapy	IG 100 mg/kg baicalein	6
Low-doseb	IG 50 mg/kg baicalein	6
High-dosec	IG 100 mg/kg baicalein	6

Notes:

a Intragastric gavage;

b low-dose prevention group;

c high-dose prevention group.

Abbreviations: IG, intragastric gavage; NS, normal saline.

Table 2 Primers used for qRT-PCR analysis

Gene	Primer sequence
	Forward (5′–3′)	Reverse (5′–3′)
SATB1	TGCAAAGGTTGCAGCAACCAAAAGC	AACATGGATAATGTGGGGCGGCCT
Axin2	CTGGCTCCAGAAGATCACAAAG	ATCTCCTCAAACACCGCTCCA
Cyclin D1	ACCATTCCATTTCCAAGC	CACCACAGTGGCCCACAC
E-cadherin	TGCCCAGAAAATGAAAAAGG	GTGTATGTGGCAATGCGTTC
Vimentin	GAGAACTTTGCCGTTGAAGC	GCTTCCTGTAGGTGGCAATC
SNAIL	TAGCGAGTGGTTCTTCTGCG	GGGCTGCTGGAAGGTAAACT
GAPDH	TGTTGCCATCAATGACCCCTT	CTCCACGACGTACTCAGCG

Abbreviation: qRT-PCR, quantitative reverse transcription polymerase chain reaction.

Table 3 Effect of baicalein on proliferation of MDA-MB-231 cells ($\overline{x}\pm \mathrm{s}$, n=6)

Concentration (μmol/L)	24 hours		48 hours		72 hours
	OD	IR (%)	OD	IR (%)	OD	IR (%)
0	0.395±0.030	0	0.647±0.022	0	1.265±0.015	0
20	0.419±0.031	−6.08*	0.585±0.043	9.58*	1.118±0.006	11.59**
40	0.333±0.034	7.71**	0.475±0.033	26.58*	0.390±0.033	69.16**
60	0.308±0.021	11.50**	0.347±0.040	46.30**	0.179±0.021	85.87**
80	0.136±0.007	41.36**	0.214±0.033	66.92**	0.027±0.007	97.87**
100	0.107±0.013	47.95**	0.199±0.018	75.19**	0.023±0.014	98.17**
120	0.049±0.019	87.36**	0.068±0.026	89.49**	0.014±0.001	98.88**

Note:

* P<0.05 and

** P<0.01 compared with the control group.

Abbreviations: OD, optical density; IR, inhibition ratio.

Figure 2 Baicalein inhibits the proliferation of MDA-MB-231 cells.

Notes: Cell viability was measured by MTT assay. Values were represented as mean ± SD of three independent experiments performed in triplicate. *P<0.05 and **P<0.01 compared with control group.
Abbreviations: SD, standard deviation; MTT, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxyme-thoxyphenyl)-2-(4-ulfophenyl)-2H-tetrazolium.

Figure 3 Baicalein inhibits the motility of MDA-MB-231 cells.

Notes: (A) Monolayers of MDA-MB-231 cells were wounded and then incubated in media containing 2% FBS with varying concentrations of baicalein (0, 10, 20, and 40 μmol/L) for 24 hours. Pictures were taken at 0, 12, and 24 hours after addition of baicalein. (B) Quantification of the wound healing assay. *P<0.05 compared with control; **P<0.01 compared with control. Data are presented as the mean ± SD of three separate experiments.
Abbreviations: FBS, fetal bovine serum; SD, standard deviation; h, hours.

Figure 4 Baicalein inhibits the invasiveness of MDA-MB-231 cells.

Notes: (A) MDA-MB-231 cells were pretreated with 0, 10, 20, and 40 μmol/L baicalein for 24 hours and were then seeded in the upper wells. FBS (10%) was added to the bottom chambers for 24 hours to induce cell invasion. After 24 hours, cells on the bottom side of the filter were fixed, stained, and counted. (B) The percent invasion rate was expressed as a percentage of the control (0 μmol/L). Values represent the mean ± SD of three independent experiments performed in triplicate. **P<0.01 compared with control group.
Abbreviations: FBS, fetal bovine serum; SD, standard deviation.

Figure 5 Baicalein suppresses liver metastasis of breast cancer in vivo.

Notes: Macroscopic findings of liver metastasis in the control group (A) and the high-dose prevention group (B). Microscopic findings of liver metastases in control group (C) and hardly seen metastatic lesions in high-dose prevention group (D). The black arrows show the lung metastases in each group, magnification of 100×.

Figure 6 Baicalein suppresses lung metastasis of breast cancer in vivo.

Notes: Macroscopic findings of lung metastasis in the control group (A) and the high-dose prevention group (B). (C) Histologically proven lung metastases in control group (100×). (D) Metastatic lesions are hardly to be seen in some mouse lung tissue of high-dose prevention group (100×). The black arrows show the lung metastases in each group.

Figure 7 SATB1 expression correlates with the invasiveness of breast cancer cell lines.

Notes: (A) Western blot analysis of SATB1 levels in immortalized mammary epithelial cells (MCF-10A), non-aggressive breast cancer cell lines (MCF7 and SKBR3) and aggressive breast cancer cell line MDA-MB-231. (B) Quantification of the protein levels of SATB1. Values represent the mean ± SD of three independent experiments performed in triplicate. *P<0.05 and **P<0.01 compared with the control group.
Abbreviation: SD, standard deviation.

Figure 8 Baicalein suppresses the expression of SATB1 in MDA-MB-231 cells.

Notes: (A) The effect of baicalein on the expression levels of SATB1 mRNA was assessed by qRT-PCR. (B) MDA-MB-231 cells were treated with baicalein (0, 10, 20, and 40 μmol/L) for 24 or 48 hours and then subjected to Western blotting to analyze the protein levels of SABT1. (C) Quantification of the protein levels of SATB1. Values represent the mean ± SD of three independent experiments performed in triplicate. *P<0.05 and **P<0.01 compared with the control group.
Abbreviations: mRNA, messenger RNA; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SD, standard deviation.

Figure 9 Baicalein suppresses the expression of vimentin in MDA-MB-231 cells.

Notes: (A) The effects of baicalein on the expression levels of vimentin mRNA was assessed by qRT-PCR. (B) MDA-MB-231 cells were treated with baicalein (0, 10, 20, and 40 μmol/L) for 24 or 48 hours and then subjected to Western blotting to analyze the protein levels of vimentin. (C) Quantification of the protein levels of vimentin. Values represent the mean ± SD of three independent experiments performed in triplicate. *P<0.05 and **P<0.01 compared with the control group.
Abbreviations: mRNA, messenger RNA; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SD, standard deviation.

Figure 10 Baicalein suppresses the expression of SNAIL in MDA-MB-231 cells.

Notes: (A) The effects of baicalein on the expression levels of SNAIL mRNA was assessed by qRT-PCR. (B) MDA-MB-231 cells were treated with baicalein (0, 10, 20, and 40 μmol/L) for 24 or 48 hours and then subjected to Western blotting to analyze the protein levels of SNAIL. (C) Quantification of the protein levels of SNAIL. Values represent the mean ± SD of three independent experiments performed in triplicate. *P<0.05 and **P<0.01 compared with the control group.
Abbreviations: mRNA, messenger RNA; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SD, standard deviation.

Figure 11 Baicalein increases the expression of E-cadherin in MDA-MB-231 cells.

Notes: (A) The effects of baicalein on the expression levels of E-cadherin mRNA was assessed by qRT-PCR. (B) MDA-MB-231 cells were treated with baicalein (0, 10, 20, and 40 μmol/L) for 24 or 48 hours and then subjected to Western blotting to analyze the protein levels of E-cadherin. (C) Quantification of the protein levels of E-cadherin. Values represent the mean ± SD of three independent experiments performed in triplicate. **P<0.01 compared with the control group.
Abbreviations: mRNA, messenger RNA; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SD, standard deviation.

Figure 12 Baicalein inhibits the expression of Wnt1 in MDA-MB-231 cells.

Notes: (A) MDA-MB-231 cells were treated with baicalein (0, 10, 20, and 40 μmol/L) for 24 or 48 hours and then subjected to Western blotting to analyze the protein levels of Wnt1. (B) Quantification of the protein levels of Wnt1. Values represent the mean ± SD of three independent experiments performed in triplicate. **P<0.01 compared with the control group.
Abbreviation: SD, standard deviation.

Figure 13 Baicalein inhibits the expression of β-catenin in MDA-MB-231 cells.

Notes: (A) The effects of baicalein on the expression levels of β-catenin mRNA was assessed by qRT-PCR. (B) MDA-MB-231 cells were treated with baicalein (0, 10, 20, and 40 μmol/L) for 24 or 48 hours and then subjected to Western blotting to analyze the protein levels of β-catenin. (C) Quantification of the protein levels of β-catenin. Values represent the mean ± SD of three independent experiments performed in triplicate. *P<0.05 and **P<0.01 compared with the control group.
Abbreviations: mRNA, messenger RNA; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SD, standard deviation.

Figure 14 Baicalein suppresses the expression of Axin2 and Cyclin D1 in MDA-MB-231 cells.

Notes: (A) The effects of baicalein on the expression level of Axin2 mRNA was assessed by qRT-PCR. MDA-MB-231 cells were treated with baicalein (0, 10, 20, and 40 μmol/L) for 24 or 48 hours and then subjected to qRT-PCR to analyze the mRNA levels of Axin2. (B) The effects of baicalein on the expression levels of Cyclin D1 mRNA was assessed by qRT-PCR. Values represent the mean ± SD of three independent experiments performed in triplicate. *P<0.05 and **P<0.01 compared with the control group.
Abbreviations: mRNA, messenger RNA; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SD, standard deviation.

Figure 15 Representative SATB1, Wnt1, β-catenin, E-cadherin, vimentin, and SNAIL expression in lung metastases of nude mouse model by immunohistochemistry.

Notes: (A1-1–4) Representative SATB1 expression. (B1-1–4) Representative Wnt1 expression. (C1-1–4) Representative β-catenin expression. (D1-1–4) Representative E-cadherin expression. (E1-1–4) Representative vimentin expression. (F1-1–4) Representative SNAIL expression. 1) Control group; 2) therapy group; 3) low-dose prevention group; 4) high-dose prevention group (100×).

Figure 16 Representative SATB1, Wnt1, β-catenin, E-cadherin, vimentin, and SNAIL expression in liver metastases of nude mouse model assessed by immunohistochemistry.

Notes: (A2-1–4) Representative SATB1 expression. (B2-1–4) Representative Wnt1 expression. (C2-1–4) Representative β-catenin expression. (D2-1–4) Representative E-cadherin expression. (E2-1–4) Representative vimentin expression. (F2-1–4) Representative SNAIL expression. 1) Control group; 2) therapy group; 3) low-dose prevention group; 4) high-dose prevention group (100×).

Figure 17 Expression of SATB1, Wnt1, β-catenin, E-cadherin, vimentin, and SNAIL in metastases of nude mouse model assessed by Western blot.

Notes: (A) Expression of different proteins in lung metastases. (B) Expression of different proteins in liver metastases. Quantification of the protein levels of SATB1, Wnt1, β-catenin, vimentin, and SNAIL in lung (C) and liver (D) metastases of control and therapy group. Quantification of the protein levels of SATB1, Wnt1, β-catenin, vimentin, and SNAIL in lung (E) and liver (F) metastases of control and two prevention groups. (G) Quantative comparison of E-cadherin protein expression in lung/liver metastases between control and therapy group. (H) Quantative comparison of E-cadherin protein expression in lung/liver metastases between control and two prevention groups. *P<0.05 and **P<0.01 compared with the control group.