Distinct role of the Fas rs1800682 and FasL rs763110 polymorphisms in determining the risk of breast cancer among Han Chinese females

Figures & data

Table 1 Primers used for this study

SNP_ID	First-PCRP	Second-PCRP	UEP-SEQ
rs1800682	ACGTTGGATGTTGTGGCTGCAACATGAGAG	ACGTTGGATGCTTTTCAGAGCCCTATGGCG	tGTTAACTGTCCATTCCAG
rs763110	ACGTTGGATGCTGGGCAAACAATGAAAATG	ACGTTGGATGAGGCTGCAAACCAGTGGAAC	tcaaAGAGCTGCTTTGTATTTC

Abbreviations: PCRP, polymerase chain reaction primer; SNP, single nucleotide polymorphism; UEP-SEQ, unextension primer sequence.

Table 2 The characteristics of breast cancer cases and cancer-free controls

Characteristics	Cases	Controls	P-value
Number	560	583
Age (years, mean ± SD)	49.09±11.02	48.80±8.28	0.612
<49	294	311
≥49	266	272
Menopausal status
Premenopausal	264	281
Postmenopausal	296	302	0.716
Number of pregnancies and live births
<2	289	291	0.594
≥2	271	292
Body mass index (kg/m^2) (mean ± SD)	22.52±2.84	22.95±3.21	0.038
Tumor size
<2 cm	188
≥2 cm	372
LN metastasis
Negative	236
Positive	324
ER
Negative	247
Positive	313
PR
Negative	255
Positive	305
HER2
Negative	389
Positive	171
Ki67
<14%	195
≥14%	365

Note: The bold value indicates that the difference was significant.

Abbreviations: ER, estrogen receptor; HER2, human epidermal growth factor receptor 2; LN, lymph node; PR, progesterone receptor; SD, standard deviation.

Table 3 Genotype frequencies of Fas/FasL polymorphisms in cases and controls

Model	Genotype	Cases (n, %)	Controls (n, %)	P-value*	OR (95% CI)	Study power
Fas rs1800682	HWE: P=0.163
Codominant	AA	182 (32.5)	226 (38.8)	1.00
Heterozygote	AG	289 (51.6)	261 (44.8)	0.015	1.37 (1.06–1.78)	0.964
Homozygote	GG	89 (15.9)	96 (16.4)	0.428	1.15 (0.81–1.63)
Dominant	AA	226 (38.8)	182 (32.5)	1.00
	AG+GG	357 (61.2)	378 (67.5)	0.027	1.32 (1.03–1.68)	0.856
Recessive	AA+AG	487 (83.6)	471 (84.1)	1.00
	GG	96 (16.4)	89 (15.9)	0.792	0.96 (0.70–1.31)
Overdominant	AA+GG	322 (55.2)	271 (48.4)	1.00
	AG	261 (44.8)	289 (51.6)	0.021	1.32 (1.04–1.66)	0.910
Allele	A	713 (61.1)	653 (58.3)	1.00
	G	453 (38.9)	467 (41.7)	0.165	1.13 (0.95–1.33)
FasL rs763110	HWE: P=0.817
Codominant	CC	303 (54.1)	276 (47.3)	1.00
Heterozygote	CT	219 (39.1)	252 (43.2)	0.060	0.79 (0.62–1.01)
Homozygote	TT	38 (6.8)	55 (9.5)	0.040	0.63 (0.40–0.98)	0.834
Dominant	CC	303 (54.1)	276 (47.3)	1.00
	CT+TT	257 (45.9)	307 (52.7)	0.022	0.76 (0.60–0.96)	0.906
Recessive	CC+CT	522 (93.2)	528 (90.5)	1.00
	TT	38 (6.8)	55 (9.5)	0.102	0.70 (0.45–1.08)
Overdominant	CC+TT	341 (60.9)	331 (56.8)	1.00
	CT	219 (39.1)	252 (43.2)	0.157	0.84 (0.67–1.07)
Allele	C	825 (73.7)	804 (69.0)	1.00
	T	295 (26.3)	362 (31.0)	0.013	0.79 (0.66–0.95)	0.719

Notes:

* Adjusted for age and body mass index. The bold values indicate that the differences were significant.

Abbreviations: CI, confidence interval; HWE, Hardy–Weinberg equilibrium; OR, odds ratio.

Table 4 Association between Fas/FasL SNPs and age of breast cancer patients

Age (years)	(AA/Aa/aa)		Codominant		Dominant		Recessive		Allele
	Case	Control	P-value	OR (95% CI)	P-value	OR (95% CI)	P-value	OR (95% CI)	P-value	OR (95% CI)
	rs1800682
<49	81/166/47	101/156/54	0.128m	1.33 (0.92–1.91)m	0.187	1.27 (0.89–1.79)	0.650	0.91 (0.59–1.39)	0.534	1.08 (0.86–1.35)
			0.742n	1.09 (0.67–1.77)n
≥49	101/113/52	125/105/42	0.132m	1.33 (0.92–1.94)m	0.061	1.39 (0.99–1.96)	0.210	1.33 (0.85–2.08)	0.041	1.29 (1.01–1.66)
			0.083n	1.53 (0.95–2.49)n
	rs763110
<49	169/106/19	161/124/26	0.233m	0.81 (0.58–1.14)m	0.158	0.79 (0.58–1.09)	0.374	0.76 (0.41–1.40)	0.134	0.82 (0.64–1.06)
			0.258n	0.70 (0.37–1.31)n
≥49	134/113/19	115/128/29	0.125m	0.76 (0.53–1.08)m	0.060	0.72 (0.51–1.04)	0.152	0.65 (0.35–1.18)	0.040	0.76 (0.59–0.99)
			0.071n	0.56 (0.30–1.06)n

Notes: A represents major allele; a represents minor allele;

m represents heterozygote model;

n represents homozygote model. The bold values indicate that the differences were significant.

Abbreviations: CI, confidence interval; OR, odds ratio; SNP, single nucleotide polymorphism.

Table 5 Association between Fas/FasL SNPs and menopausal status of breast cancer patients

Menopausal status	(AA/Aa/aa)		Codominant		Dominant		Recessive		Allele
	Case	Control	P-value	OR (95% CI)	P-value	OR (95% CI)	P-value	OR (95% CI)	P-value	OR (95% CI)
	rs1800682
Premenopausal	87/128/49	114/121/46	0.086m 0.181n	1.39 (0.9–2.01)m 1.40 (0.86–2.28)n	0.066	1.39 (0.98–1.97)	0.501	1.16 (0.75–1.81)	0.099	1.23 (0.96–1.56)
Postmenopausal	95/161/40	112/140/50	0.093m 0.818n	1.36 (0.95–1.93)m 0.94 (0.57–1.55)n	0.200	1.25 (0.89–1.75)	0.298	0.79 (0.50–1.24)	0.731	1.04 (0.83–1.31)
	rs763110
Premenopausal	147/99/18	144/105/32	0.664m 0.058n	0.92 (0.65–1.32)m 0.55 (0.30–1.03)n	0.299	0.84 (0.60–1.17)	0.065	0.57 (0.31–1.04)	0.098	0.80 (0.61–1.04)
Postmenopausal	156/120/20	132/147/23	0.030m 0.348n	0.69 (0.49–0.97)m 0.74 (0.39–1.40)n	0.028	0.70 (0.51–0.96)	0.684	0.88 (0.47–1.64)	0.062	0.79 (0.62–1.01)

Notes: A represents major allele; a represents minor allele;

m represents heterozygote model;

n represents homozygote model. The bold values indicate that the differences were significant.

Abbreviations: CI, confidence interval; OR, odds ratio; SNP, single nucleotide polymorphism.

Table 6 Association between the Fas/FasL SNPs and clinical characteristics of breast cancer patients

Variables	AA	Aa	aa	Codominant		Dominant		Recessive		Allele
				P-value	OR (95% CI)	P-value	OR (95% CI)	P-value	OR (95% CI)	P-value	OR (95% CI)
rs1800682
Tumor size
<2 cm	67	96	25	1.00 (reference)
≥2 cm	115	193	64	0.425m 0.154n	1.17 (0.79–1.73)m 1.49 (0.86–2.59)n	0.218	0.26 (0.87–1.83)	0.232	1.36 (0.82–2.23)	0.167	1.20 (0.93–1.54)
LN metastasis
Negative	84	121	31	1.00 (reference)
Positive	98	168	58	0.361m 0.077n	1.19 (0.82–1.73)m 1.60 (0.95–2.71)n	0.182	1.27 (0.89–1.82)	0.128	1.44 (0.90–2.31)	0.090	1.23 (0.97–1.57)
ER
Negative	90	119	38	1.00 (reference)
Positive	92	170	51	0.078m 0.296n	1.40 (0.96–2.03)m 1.31 (0.79–2.19)n	0.077	1.38 (0.97–1.97)	0.770	1.07 (0.68–1.69)	0.180	1.18 (0.93–1.50)
PR
Negative	89	122	44	1.00 (reference)
Positive	93	167	45	0.155m 0.934n	1.31 (0.90–1.90)m 0.98 (0.59–1.63)n	0.267	1.22 (0.86–1.74)	0.420	0.83 (0.53–1.31)	0.747	1.04 (0.82–1.32)
HER2
Negative	134	193	62	1.00 (reference)
Positive	48	96	27	0.116m 0.493n	1.39 (0.92–2.09)m 1.22 (0.70–2.13)n	0.138	1.35 (0.91–2.00)	0.965	0.99 (0.60–1.62)	0.330	1.14 (0.88–1.47)
KI67
<14%	61	108	26	1.00 (reference)
≥14%	121	181	63	0.396m 0.476n	0.85 (0.57–1.25)m 1.22 (0.70–2.12)n	0.653	0.92 (0.63–1.33)	0.226	1.36 (0.83–2.22)	0.739	1.04 (0.81–1.34)
rs763110
Tumor size
<2 cm	98	79	11	1.00 (reference)
≥2 cm	205	140	27	0.374m 0.672n	0.85 (0.59–1.22)m 1.17 (0.56–2.46)n	0.504	0.89 (0.62–1.26)	0.532	1.26 (0.61–2.60)	0.778	0.96 (0.73–1.27)
LN metastasis
Negative	117	98	21	1.00 (reference)
Positive	186	121	17	0.160m 0.049n	0.78 (0.55–1.11)m 0.51 (0.26–1.01)n	0.066	0.73 (0.52–1.02)	0.090	0.57 (0.29–1.10)	0.031	0.75 (0.57–0.97)
ER
Negative	121	109	17	1.00 (reference)
Positive	182	200	21	0.234m 0.570n	1.22 (0.88–1.69)m 0.82 (0.42–1.62)n	0.342	1.17 (0.85–1.60)	0.378	0.74 (0.38–1.44)	0.680	1.05 (0.82–1.35)
PR
Negative	144	88	23	1.00 (reference)
Positive	159	131	15	0.096m 0.131n	1.35 (0.95–1.92)m 0.59 (0.30–1.18)n	0.305	1.19 (0.85–1.66)	0.055	0.52 (0.27–1.02)	0.964	1.01 (0.77–1.31)
HER2
Negative	221	146	22	1.00 (reference)
Positive	82	73	16	0.122m 0.053n	1.35 (0.92–1.97)m 1.43 (1.00–2.05)n	0.053	1.43 (1.00–2.05)	0.109	1.72 (0.88–3.37)	0.028	1.37 (1.03–1.18)
KI67
<14%	103	74	18	1.00 (reference)
≥14%	200	145	20	0.961m 0.104n	1.01 (0.70–1.46)m 0.57 (0.29–1.13)n	0.655	0.92 (0.65–1.31)	0.975	1.01 (0.72–1.40)	0.300	0.86 (0.66–1.14)

Notes: A represents major allele; a represents minor allele;

m represents heterozygote model;

n represents homozygote model. The bold values indicate that the differences were significant.

Abbreviations: CI, confidence interval; ER, estrogen receptor; HER2, human epidermal growth factor receptor 2; LN, lymph node; OR, odds ratio; PR, progesterone receptor; SNP, single nucleotide polymorphism.

Table 7 The haplotype frequencies of Fas/FasL SNPs and breast cancer risk

Haplotypes		Cases (N=1,120) n, %	Controls (N=1,166) n, %	OR (95% CI)	P-value
rs1800682	rs763110
A	C	544 (48.57)	556 (47.68)	1.00 (reference)
A	T	109 (9.73)	157 (13.46)	0.70 (0.53–0.91)	0.009
G	C	281 (25.09)	248 (21.27)	1.14 (0.92–1.40)	0.224
G	T	186 (16.61)	205 (17.58)	0.91 (0.72–1.15)	0.426

Note: The bold value indicates that the difference was significant.

Abbreviations: CI, confidence interval; OR, odds ratio; SNP, single nucleotide polymorphism.