Autophagy inhibition enhances RAD001-induced cytotoxicity in human bladder cancer cells

Figures & data

Figure 1 RAD001 decreased cell viability in human bladder cancer cells.

Notes: (A) Cell viability of bladder cancer cells treated with various concentration of RAD001 for 24 hours. Cells were seed in 96-well plates for 24 hours before the addition of indicated concentration of RAD001. The cell viability was then detected at 24 hours of treatment using WST-8 cell viability kit. Four bladder cancer cell lines were used: RT4 (Grade I TCC; wild-type p53), 5637 (Grade II TCC; mutant p53), HT1376 (Grade III TCC; mutant p53), and T24 (Grade III TCC; mutant p53). (B) Cell viability of RT4, 5637, HT1376, and T24 cells upon RAD001 treatment for 24, 48, and 72 hours. Cell viabilities of these cells treated with 0–5 µM RAD001 as described in (A). The values are shown as the mean ± SD of three independent experiments; *P<0.05.
Abbreviations: SD, standard deviation; TCC, transitional cell carcinoma.

Figure 2 Inhibition of mTOR-related genes and mTORC1 downstream effectors by RAD001.

Notes: qPCR detection of mTOR-related genes, including (A) mTOR complexes, (B) mTORC1-positive regulation, and (C) mTORC2-positive regulation in T24 cells treated with 1 or 5 µM RAD001. Cells were seeded 24 hours before RAD001 treatment. Total RNA samples were extracted at 24 hours posttreatment, reverse transcribed, and subjected to the detection of genes involved in mTOR signaling. The values are shown as the mean ± SD of three independent experiments; *P<0.05. (D) Protein samples were isolated at indicated time points then subjected to the detection of p-4EBP1 and p-RPS6 by Western blot.
Abbreviations: mTOR, mammalian target of rapamycin; SD, standard deviation; p-4EBP1, phospho-4EBP1; p-RPS6, phospho-RPS6; mTORC1, mTOR complex 1; mTORC2, mTOR complex 2; qPCR, quantitative polymerase chain reaction; mRNA, messenger RNA.

Figure 3 RAD001 induces autophagy in human bladder cancer cells.

Notes: (A) Detection of AVO formation by AO vital staining in RT4, 5637, and T24 cells treated with 1 µM RAD001 with or without 2 hours pretreatment of 200 nM Baf A1. Representative photos from three independent experiments with similar results are shown. Scale bar: 50 µm. (B) Quantitative detection of AVO formation was determined using flow cytometry. Treated cells were collected immediately after AO staining and the percentage of red-fluorescent-positive cells compared to control was measured using flow cytometry. Data are from three independent experiments with similar results and are presented as mean ± SD; *P<0.05. (C) Detection of LC3-II processing and (D) autophagic flux was detected by monitoring the expression level of p62 and LC3-II in cells treated with 0–5 µM RAD001 for 24 hours and cells treated with 1 µM RAD001 with or without the cotreatment of 200 nM Baf A1, respectively. The relative band intensities of p62 and LC3-II were quantitated by denstometric scanning and the relative expression levels are presented as the fold of control cells (lower panels in C and D). The statistical calculation from blots of three independent experiments is shown. The results are presented as the mean ± SD; *P<0.05.
Abbreviations: AVO, acidic vesicular organelle; AO, acridine orange; SD, standard deviation; Baf A1, bafilomycin A1.

Figure 4 Inhibition of autophagy increases RAD001-induced cytotoxicity.

Notes: Cell viability of (A) RT4, (B) 5637, and (C) T24 cells treated with 1 or 5 µM RAD001 with or without the cotreatment of 1 or 3 mM 3-MA, 100 or 200 nM Baf A1, or 25 or 50 µM CQ for 72 hours. Cell viability was detected using WST-8 reagent, and the values are shown as the mean ± SD of three independent experiments; *P<0.05. #P<0.05 when compared to RAD001 treatment group.
Abbreviations: Baf A1, bafilomycin A1; CQ, chloroquine; SD, standard deviation; 3-MA, 3-methyladenine.

Figure 5 Coordinate inhibition of autophagy and mTOR enhances apoptosis in human bladder cancer cells.

Notes: Caspase 3/7 activity was detected in RT4, 5637, and T24 cells treated with 1 µM RAD001 with or without the cotreatment of 3 mM 3-MA or 200 nM Baf A1 for 24 hours. The data from three independent experiments are shown. The results are presented as the mean ± SD; *P<0.05.
Abbreviations: mTOR, mammalian target of rapamycin; SD, standard deviation; Baf A1, bafilomycin A1; 3-MA, 3-methyladenine.

Table S1 Primer sequences for qPCR detection of mTOR-related genes

Gene symbol	Description	Genbank accession number	Forward primer	Reverse primer	Amplicon	Functional categories
mTOR	Mechanistic target of rapamycin (serine/threonine kinase)	NM_004958	AGGCCGCATTGTCTCTATCAA	GCAGTAAATGCAGGTAGTCATCCA	80	mTORC1; mTORC2
MLST8	MTOR-associated protein, LST8 homologue (Saccharomyces cerevisiae)	NM_022372	TGTGGGCTTCCACGAAGAC	AGTTAATGGGTGCGTTCACCT	128	mTORC1; mTORC2
RPTOR	Regulatory associated protein of MTOR, complex 1	NM_020761	ACTGGAACCTACCTTTGGCTT	ACTGTCTTCATCCGATCCTTCA	106	mTORC1
RITOR	RPTOR-independent companion of mTOR, complex 2	NM_152756	TCCAAAGACTCGACAGTATGTGC	GGCTAGAAATCGTGCTTCTCTG	139	mTORC2
EIF4B	Eukaryotic translation initiation factor 4B	NM_001417	TCCCAAATCGCCACCCTAC	TGGTAAACGCACTGCACTGA	112	mTORC1-positive regulation; translation
RPS6	Ribosomal protein S6	NM_001010	TGGACGATGAACGCAAACTTC	TTCGGACCACATAACCCTTCC	102	mTORC1-positive regulation; translation
RPS6KB1	Ribosomal protein S6 kinase, 70 kDa, polypeptide 1	NM_003161	AGAACTTCTGGCTCGAAAGGT	CGACAGGTGTCTGACGTGTAA	104	mTORC1-positive regulation; translation
AKT1	V-akt murine thymoma viral oncogene homologue 1	NM_005163	AGCGACGTGGCTATTGTGAAG	GCCATCATTCTTGAGGAGGAAGT	96	Co-regulator of autophagy and apoptosis
GSK3B	Glycogen synthase kinase 3 beta	NM_002093	AGACGCTCCCTGTGATTTATGT	CCGATGGCAGATTCCAAAGG	89	mTORC2-positive regulation

Abbreviations: mTOR, mammalian target of rapamycin; SD, standard deviation; qPCR, quantitative polymerase chain reaction.