Plasmodium-infected erythrocytes (pRBC) induce endothelial cell apoptosis via a heme-mediated signaling pathway

Figures & data

Table 1 Primers for real-time polymerase chain reaction

Primer set	Forward primer (5′→3′)	Reverse primer (5′→3′)
BAG3	gcaccactacgtggaacgac	ggtacacagggtggccttc
BCL2A1	tcatattttgttgcggagttc	tccagccagatttaggttcaa
BCL2L10	ctgggatggcttttgtcact	ccagagataaatgaaggctgttg
BIRC3	tcaacatgccaagtggtttc	tgggctgtctgatgtggata
CD40LG	gccagtttgaaggctttgtg	tgctggcctcacttatgaca
CD70	gctgcagctgaatcacacag	atacgtagctgccccttgtc
CIDEA	ccaaccatgacaggagcag	tcttcctccagcaccagagt
FASLG	tctggttgccttggtaggat	gtggcctatttgcttctcca
TNFRSF9	gatttgcagtccctgtcctc	tggaggaacactccttcctg
TNFSF10	caactccgtcagctcgttag	tgtgagctgctactctctgagg
TP73	agtcaagccgggggaataat	tgctcagcagattgaactgg
GAPDH	aacgaccccttcattgac	tccacgacatactcagcac

Abbreviations: BAG3, BCL2-associated athanogene 3; BCL2A1, BCL-2-related protein A1; BCL2L10, BCL-2-like 10, apoptosis facilitator; BIRC3, Baculoviral IAP repeat containing 3; CD40LG, CD40 ligand; CD70, CD70 molecule; CIDEA, cell death-inducing DFFA-like effector a; FASLG, Fas ligand (TNF superfamily, member 6); TNFRSF9, tumor necrosis factor receptor superfamily, member 9; TNFSF10, tumor necrosis factor (ligand) superfamily, member 10; TP73, tumor protein p73; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Figure 1 HBVECs were treated with 30 μM of heme for 24 h followed by evaluation of cell apoptosis TUNEL assay.

Notes: Apoptotic cells were identified by the presence of red fluorescence. Nuclei were stained blue by DAPI dye conterstaining (A–F). The apoptotic cells were found to be increased by heme treatment (compare A vs D and C vs F) using TUNEL assay.
Abbreviations: HBVECs, human brain microvascular endothelial cells; ctrl, control; h, hours; DAPI, 4′,6-diamidino-2-phenylindole; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling.

Figure 2 Total RNA was extracted and synthesized to cDNA and then subjected to the human apoptosis signaling pathway PCR array (PAHS-012Z).

Notes: Fold changes and P-values were calculated using Student’s t-test. A P-value <0.05 and a fold change >2.0 were considered to be a significant dysregulation. (A) A list of upregulated and downregulated genes with fold change >2. The heat map (B) and scatterplot (C) generated are also shown.
Abbreviations: PCR, polymerase chain reaction; ABL1, C-abl oncogene 1, nonreceptor tyrosine kinase; BCL2L10, BCL-2-like 10, apoptosis facilitator; BNIP3, BCL-2/adenovirus E1B 19 kDa interacting protein 3; CASP3, caspase-3, apoptosis-related cysteine peptidase; CASP4, caspase-4, apoptosis-related cysteine peptidase; CASP5, caspase-5, apoptosis-related cysteine peptidase; CD40LG, CD40 ligand; CD70, CD70 molecule; CIDEA, cell death-inducing DFFA-like effector a; CYCS, cytochrome, somatic; FASLG, Fas ligand (TNF superfamily, member 6); MCL1, myeloid cell leukemia sequence 1; TNFRSF9, tumor necrosis factor receptor superfamily, member 9; TNFSF10, tumor necrosis factor (ligand) superfamily, member 10; TP73, tumor protein p73; TRAF3, TNF receptor-associated factor 3; BAG1, BCL-2-associated athanogene; BAG3, BCL-2-associated athanogene 3; BCL-2, B-cell CLL/lymphoma 2; BCL2A1, BCL-2-related protein A1; BIRC3, Baculoviral IAP repeat containing 3; BNIP3L, BCL-2/adenovirus E1B 19 kDa interacting protein 3-like.

Figure 3 Eleven genes (BCL2L10, CD40LG, CD70, CIDEA, FASLG, TNFRSF9, TNFSF10, TP73, BIRC3, BAG3, and BCL2A1) involved in apoptosis were validated by qPCR analysis from 16 upregulated genes and six downregulated genes at a threshold of greater than twofold expression alteration of DNART² profile PCR array-based gene expression profiling data.

Notes: The decrease in mRNA expression detected by microarray profiling was confirmed by qPCR for all eight genes (BCL2L10, CD40LG, CD70, CIDEA, FASLG, TNFRSF9, TNFSF10, and TP73), and the increase in mRNA expression detected by microarray profiling was confirmed by qPCR for another three genes (BIRC3, BAG3, and BCL2A1). *P<0.05; **P<0.01.
Abbreviations: BCL2L10, BCL-2-like 10, apoptosis facilitator; CD40LG, CD40 ligand; CD70, CD70 molecule; CIDEA, cell death-inducing DFFA-like effector a; FASLG, Fas ligand (TNF superfamily, member 6); TFF9, tumor necrosis factor receptor superfamily, member 9; TNFSF10, tumor necrosis factor (ligand) superfamily, member 10; TP73, tumor protein p73; BIRC3, Baculoviral IAP repeat containing 3; BAG3, BCL-2-associated athanogene 3; BCL2A1, BCL-2-related protein A1; qPCR, quantitative polymerase chain reaction; Ctrl, control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Figure 4 Heme-mediated induction of FASLG and TP73 and reduction of BCL-2 were verified by Western blot.

Abbreviations: FASLG, fas ligand (TNF superfamily, member 6); TP73, tumor protein p73; BCL-2, B-cell CLL/lymphoma 2; FasL, fas ligand; h, hours; ctrl, control.

Figure 5 Silencing of p73 by siRNA protects HBVECs from heme-induced apoptosis as measured by TUNEL assay.

Notes: Heme-induced apoptosis in HBVECs as seen by TUNEL assay (A–F and M), while silencing p73 by siRNA inhibits heme-mediated apoptosis (G–L and M). Panel N shows the downregulation of p73 mRNA with p73 siRNA transfection as measured by qPCR and Western blot.
Abbreviations: siRNA, small interfering RNA; HBVECs, human brain microvascular endothelial cells; qPCR, quantitative polymerase chain reaction; DAPI, 4′,6-diamidino-2-phenylindole; ctrl, control.

ClarkIARockettKACowdenWBProposed link between cytokines, nitric oxide and human cerebral malariaParasitol Today19917820520715463497

 PubMedGoogle Scholar