Qihu Preparation Ameliorates Diabetes by Activating the AMPK Signaling Pathway in db/db Mice

Figures & data

Table 1 Sequences of Primers Used in qRT-PCR

Genes		Sequences
IL-1β	F	AGTTGACGGACCCCAAA
	R	TCTTGTTGATGTGCTGCTG
IL-6	F	TTCACAAGTCGGAGGCTTA
	R	CAAGTGCATCATCGTTGTTC
TXNIP	F	CGGACGGGTAATAGTGGA
	R	TGTGTCTTCATAGCGCAAG

Abbreviations: F, forward primer; R, reverse primer.

Table 2 Main Components of Qihu

NO.	Formula	Mass	Extraction	Found At	Error	Found At	RT Delta	RT %
		(Da)	Mass (Da)	Mass (Da)	(ppm)	RT (min)	(min)	Error
1	C15H10O7	302.04265	303.04993	303.04987	−0.2	7.4	7.4	0
2	C10H10O4	194.05791	195.06519	195.06531	0.6	8.95	8.95	0
3	C16H25NO2	263.18853	264.19581	264.19484	−3.7	9.07	9.07	0
4	C30H50O2	442.38108	443.38836	443.38846	0.2	9.15	9.15	0
5	C16H18O4	274.12051	275.12779	275.12661	−4.3	9.2	9.2	0
6	C27H32O14	580.17921	581.18648	581.18833	3.2	9.33	9.33	0
7	C47H80O18	932.53447	933.54174	933.54173	0	10.02	10.02	0
8	C54H92O23	1108.60294	1109.61022	1109.60802	−2	12.68	12.68	0

Figure 1 The results of the HPLC-ESI-Q-TOF analysis of Qihu. The results of the HPLC-ESI-Q-TOF analysis of Qihu. (A) The main components chemical structures of Qihu were 1. Quercetin, 2. Ferulic acid, 3. Dendrobine, 4. Sophoradiol, 5. Gigantol, 6. Naringin, 7. Notoginsenoside R1, and 8. Ginsenoside Rb1. (B) All of these compounds are the main ingredients of Panax notoginseng, Dendrobium nobile, Astragalus membranaceus and Pueraria lobata, etc.

Figure 2 The effects of Met and Qihu on food intake and body weight in db/db mice. The db/db mice were treated with 0.3% sodium carboxymethyl cellulose (CMC-Na, used as DM control), Met or different doses of Qihu as described in methods. BKS mice were used as the negative control group, which was intragastrically administered with 0.3% CMC-Na. (A) The food intake was measured for 3 consecutive days every week for 4 weeks, and then the average food intake per animal was calculated. (B) The body weight was monitored once a week. All data were expressed as mean ± SD (n = 7–8). ^## p < 0.01 vs NC, *p < 0.05 or **p < 0.01 vs DM.

Figure 3 The effects of Met and Qihu on the levels of blood glucose and TG in db/db mice. (A) The effects of Met and Qihu on the levels of blood glucose in db/db mice. The blood glucose levels were monitored once a week. (B) The effect of Met and Qihu on glucose tolerance in db/db mice. (C) The effect of Met and Qihu on TG levels in db/db mice. All data were expressed as mean ± SD (n = 7–8). ^# p < 0.05 or ^## p < 0.01 vs NC, *p < 0.05 or **p < 0.01 vs DM.

Table 3 Pathological Scoring Criteria of Liver

Scoring Criteri	Pathological Grade
Hepatocyte cord structure disappears, hepatocytes swell and steatosis occurs.	3
Obvious fat deposition can be observed
Hepatic cell swelling and steatosis are alleviated	2
Hepatocytes have basically returned to normal size and steatosis has basically	1
Disappeared
Hepatocytes are densely packed, without swelling and steatosis	0

Figure 4 The effect of Met and Qihu on the pathological changes of liver in db/db mice. (A) The effect of Met and Qihu on the pathological changes of liver in db/db mice. The liver was excised from db/db mice and part of the tissues was fixed with 4% paraformaldehyde, and then embedded in paraffin and stained with hematoxylin and eosin (magnification: ×400). (B) The result of pathological score in all the groups of mice. All data were expressed as mean ± SD (n = 7–8). ^## p < 0.01 vs NC, *p < 0.05 or **p < 0.01 vs DM.

Figure 5 The effect of Qihu on the expression levels of IL-1β and IL-6 in the liver and pancreas of db/db mice. (A–D) The IL-1β and IL-6 mRNA levels in liver (A and B) and pancreas (C and D) were detected using qRT-PCR assay. (E and F) The IL-1β and IL-6 protein levels in the liver (E and F) and pancreas (G and H) were detected using ELISA analysis. All data were expressed as mean ± SD (n = 3). ^## p < 0.01 vs NC, *p < 0.05 or **p < 0.01 vs DM.

Figure 6 The effect of Qihu on AMPK signaling and TXNIP expression in the liver and pancreas of db/db mice. (A and B) The TXNIP mRNA levels in the liver (A) and pancreas (B) were detected by qRT-PCR assay. All data were expressed as mean ± SD (n = 3). (C and D) The protein levels of p-AMPK, AMPK and TXNIP in the liver (C) and pancreas (D) were detected by Western blot assay. The left panel is the representative Western blot result, and the right panel is the quantitative result of Western blot. ^# p < 0.05 or ^## p < 0.01 vs NC, *p < 0.05 or **p < 0.01 vs DM.