Viability, biofilm formation, and MazEF expression in drug-sensitive and drug-resistant Mycobacterium tuberculosis strains circulating in Xinjiang, China

Figures & data

Table 1 Primers for quantitative real-time polymerase chain reaction

Gene	Sequence (5'-3')	Gene	Sequence (5'-3')
mazE3	F: CCAGCGTATCCAGATCACC R: GCGGGTGCATACCAAACT	mazF3	F: TATGACACCACCCAATCG R: ACCTATCCACTACGCACAGC
mazE6	F: TCACCACTCATCGTCCTG R: ATGAAGACAGCTATTTCTCTGCC	mazF6	F: GGTCGGTGAGGTCAGTCTTG R: GGTGATTAGTCGTGCCGAGAT
mazE9	F: CATGCGTTGGCATAGTCATC R: TATGTGAAACGAGCGGGATT	mazF9	F: TCAAAGCCTCATCGAGCTG R: GAGGTAGCGAAGCGAACAAC
sigA	F: TCGAGGTGATCAACAAGCTG R: CTGCAGCAAAGTGAAGGACA

Figure 1 Sequence results of mazF3,6,9.

Notes: (A) mazF3; (B) mazF6; (C) mazF9.

Figure 2 SDS-PAGE and Western blot analyses to facilitate detection of recombinant protein expression.

Notes: SDS-PAGE for detection of MazF3, 6, and 9 (i); Western blot for detection of MazF3, 6, and 9 (ii). SDS-PAGE: 1, 37°C O/N whole; 2, 37°C O/N ppt; 3, 37°C O/N sup; 4, IPTG^– whole; 5, IPTG+ whole; 6, IPTG+ ppt; 7, IPTG+ sup; 8, BSA 0.5 μg; 9, BSA 1.0 μg; 10, BSA 2 μg. Western blot: 1, 37°C O/N whole; 2, 37°C O/N ppt; 3, 37°C O/N sup; 4, IPTG^– whole; 5, IPTG+ whole; 6, IPTG+ ppt; 7, IPTG+ sup; 8, negative control; 9, positive control. The arrows show recombinant protein MazF3 (Aii), MazF6 (Bii), and MazF9 (Cii), respectively.
Abbreviations: SDS-PAGE, sodium dodecyl sulfate polyacrylamide-gel electrophoresis; IPTG, isopropyl β-d-1-thiogalactopyranoside; MW, molecular weight; ppt, precipitation; sup, supernatant; BSA, bovine serum albumin.

Figure 3 Growth profiles of MTB in standard, hypoxic and nutrient starvation conditions at different culture time points.

Notes: (A) MTB incubated under standard conditions in 7H9 medium. Difference in growth ability became apparent on the eighth day, and resistant strains grew more rapidly than H37Rv (P<0.05). (B) Strains incubated under hypoxic conditions. Difference in growth ability became apparent at 2 days, 8 days, and 10 days, and resistant strains grew more rapidly than H37Rv (P<0.05). (C) Strains incubated under starvation conditions. Difference in growth ability became apparent on the sixth day. Resistant strains grew more rapidly than sensitive strains and H37Rv (P<0.05). ^#Comparison of drug-sensitive strains with H37Rv (P<0.05); *comparison of drug-resistant strains with H37Rv (P<0.05). **Comparison of drug-resistant strains with H37Rv (P<0.01).
Abbreviation: MTB, Mycobacterium tuberculosis; MCF, McFarland turbidity standards.

Figure 4 Biofilm-formation ability of drug-sensitive and drug-resistant MTB strains.

Note: There were no differences among drug-resistant strains, drug-sensitive strains, and control strain H37Rv (P>0.05).
Abbreviation: MTB, Mycobacterium tuberculosis.

Figure 5 mRNA expression of mazE3,6,9 in drug-sensitive and drug-resistant MTB strains and the control strain H37Rv.

Notes: *P<0.05; **P<0.01.
Abbreviation: MTB, Mycobacterium tuberculosis.

Figure 6 mazF3,6,9 mRNA expression in drug-sensitive and drug-resistant MTB strains and the control strain H37Rv.

Note: **P<0.01.
Abbreviation: MTB, Mycobacterium tuberculosis.

Figure 7 MazF9 protein expression in drug-sensitive and drug-resistant MTB strains.

Notes: MazF9 exhibited increased expression both in drug-sensitive strains (**P<0.01) and drug-resistant strains (*P<0.05) compared with the control strain H37Rv. The drug-sensitive strains exhibited increased expression compared with the drug-resistant strains (**P<0.01).
Abbreviations: MTB, Mycobacterium tuberculosis; SS, sensitive strain; RS, resistant strain; RV, H37Rv.

Table 2 The number of living bacteria in various conditions over time

	Day	Logarithm of counted colony numbers (log10 CFU/mL)
		2	4	6	8	10
Control	H37Rv	5.74±0.05	5.96±0.07	6.48±0.03	6.76±0.1	6.90±0.03
	H37RvAmazEF3	572±0.04	5.94±0.07	6.44±0.04	6.72±0.4	6.86±0.05
	H37RvAmazEF6	5.71 ±0.03	5.91 ±0.04	6.43±0.04	6.7±0.03	6.84±0.04
	H37RvAmazEF9	5.72±0.03	5.91 ±0.03	6.44±0.02	6.71 ±0.03	6.87±0.04
	Compare result	F=0.361	F=0.578	F= 1.07	F=0.679	F=0.869
		P>0.05	P>0.05	P>0.05	P>0.05	P>0.05
Hypoxia	H37Rv	5.27±0.06	5.81 ±0.05	5.61 ±0.09	5.1 ±0.03	4.69±0.09
	H37RvAmazEF3	5.22±0.04	6.77±0.02	5.55±0.06	5.06±0.03	4.42±0.03
	H37RvAmazEF6	5.23±0.06	5.75±0.04	5.53±0.05	5.03±0.05	4.4±0.03
	H37RvAmazEF9	5.21 ±0.04	5.76±0.03	5.54±0.03	5.04±0.03	4.41 ±0.03
	Compare result	F=0.7I6	F= 1.645	F= 1.014	F=2.207	F=22.849
		P>0.05	P>0.05	P>0.05	P>0.05	P<0.01
Nutrient starvation	H37Rv	4.6±0.06	4.35±0.06	4.15±0.07	4.07±0.05	3.62±0.1
	H37RvAmazEF3	4.53±0.02	4.32±0.06	4.11 ±0.07	3.84±0.03	3.41 ±0.02
	H37RvAmazEF6	4.52±0.035	4.27±0.061	4.09±0.087	3.78±0.04	3.37±0.031
	H37RvAmazEF9	4.54±0.051	4.28±0.082	4.1 ±0.053	3.81 ±0.03	3.39±0.032
	Compare result	F=2.141	F=0.904	F= 138.179	F=40.388	F=426.488
		P>0.05	P>0.05	P<0.01	P<0.01	P<0.01

Notes: Three deletion strains compared with H37Rv in various growth conditions. Data presented as mean ± SD.

Figure 8 Viability in parent and mazEF-deletion mutant H37Rv strains in host macrophages after infection.

Notes: Viable H37Rv, H37RvΔmazEF3, H37RvΔmazEF6, and H37RvΔmazEF9 bacteria after being phagocytosed by macrophages. Mean values from duplicates of three independent experiments are shown. *P<0.05, **P<0.01 compared to H37Rv group.

Figure 9 Host-macrophage apoptosis over time after infection with H37Rv, H37RvΔmazEF3, H37RvΔmazEF6, or H37RvΔmazEF9.

Notes: Flow-cytometry analysis of macrophage apoptosis after (A) 1, (B) 6, (C) 12, and (D) 24 hours after infection by annexin V and propidium iodide staining. Control group represents uninfected macrophages. (E) Kinetics of macrophage-apoptosis rate after infection or in uninfected controls (P<0.05).
Abbreviations: FITC, fluorescein isothiocyanate; PI, propidium iodide.