Insertion Mutation of MSMEG_0392 Play an Important Role in Resistance of M. smegmatis to Mycobacteriophage SWU1

Figures & data

Table 1 Primers Used in This Study

Name	Primer Sequence	Function
LAD-1	5ʹACGATGGACTCCAGAGCGGCCGC(G/C/A)N(G/C/A)NNNGGAA-3’	Identification of transposon insertion sites
SP-1	5’-TGATGCTCGATGAGTTTTTCTAATCAGAAT-3’	Identification of transposon insertion sites
SP-2	5ʹACGATGGACTCCAGAGTCCGGCCTGGTTAATTGGTTGTAACACTGGCAGAGC-3’	Identification of transposon insertion sites
SP-3	5’-ATCAGATCACGCATCTTCCCGACAACGCAGA-3’	Identification of transposon insertion sites
AC	5’-ACGATGGACTCCAGAG-3’	Identification of transposon insertion sites
3705-1	5’-AGGGATCCATGTCAGCACCACAGG-3’	Verification of the transposon insertion sites
3705-2	5’-GCGATCGATTCAGCGAGCCTCTTC-3’	Verification of the transposon insertion sites
KOP1	5’-AAGCTTGCGTGGTCGAACTGTT-3’	MSMEG_3705 upstream 600bp amplification
KOP2	5’-CCTCGCCGCGAGCGCAGAACAGATCTCAGCGTCTCCTCGTCGGGAT-3’	MSMEG_3705 upstream 600bp amplification
KOP3	5’-AGATCTGTTCTGCGCTCGCGGCGAGG-3’	MSMEG_3705 downstream 600bp amplification
KOP4	5’-AAGCTTGCGCCCGCACCAGGCCT-3’	MSMEG_3705 downstream 600bp amplification
KOCP1	5’-AAGGCCGTACGCGCATT-3’	Confirmation of MSMEG_3705 replacement with dif sequence
KOCP2	5’-TACGTGGCAGCCACCTCA-3’	Confirmation of MSMEG_3705 replacement with dif sequence
0392P1	5’-CCGGATCCATGTTCAGCCTCCACG-3’	Used to amplify MSMEG_0392 gene
0392P2	5’- CCGAATTCTCACATCGCCGCTTGGC-3’	Used to amplify MSMEG_0392 gene

Figure 1 Sensitivity of wild-type Mycobacterium smegmatis mc² 155 and M12 to phage SWU1. (A) wild-type M. smegmatis mc² 155 strain can form obvious plaque for SWU1. (B) M12 mutant strain cannot form plaque.

Figure 2 Detection of M12 resistance to SWU1. (A) As a blank control. (B) M12, and (C) M. smegmatis mc² 155 does not affect the replication of SWU1. Red arrows indicate plaques of phages.

Figure 3 M12 mutant strain affects SWU1 adsorption to mycobacteria. (A and B) Wild-type M. smegmatis mc² 155 can adsorb SWU1 normally. (C and D) The adsorption capacity of M12 to SWU1 was significantly lower than that of M. smegmatis mc² 155. Red arrows indicate the location of phage presence.

Figure 4 The cell wall of M12 mutant was changed. Single colony phenotype of (A) M12 mutant and (B) wild-type M. smegmatis mc² 155 strains. (C/D) The fatty acid analysis results of (C) M12 mutant strains and (D) wild-type M. smegmatis mc² 155. Red boxs indicate a significant change in the abundance of components of the content. (E) Changes of fatty acid content in cell wall of M12 mutant compared with Mycobacterium smegmatis MC² 155.

Figure 5 Transposon insertion site is located in the gene MSMEG_3705. (A) PCR amplification of MSMEG_3705 gene by specific primers. Lane 1: Marker DL8000. Lane 2/3: MSMEG_3705 amplification product using M12 as template. Lane 4/5: MSMEG_3705 amplification using M. smegmatis mc² 155 as template. Lane 6: Marker DL2000. (B) Schematic diagram of insertion of Tn5 transposon into M. smegmatis mc² 155. The asterisk indicates the transposon Tn5 insertion site.

Figure 6 Sensitivity detection of different strains to SWU1. (A) M. smegmatis mc² 155 and (B) M. smegmatis mc²155 ∆MSMEG_3705 was sensitive to SWU1. (C) M12 mutant strain cannot form plaque.

Figure 7 Sequence comparison of MSMEG_0392 products amplified from M12 and M. smegmatis mc² 155 as templates.

Figure 8 The sensitivity of M12_pNIT_MSMEG_0392 to SWU1 was detected by Direct Spot Test. (A) M. smegmatis mc² 155 and (B) M12_pNIT_MSMEG_0392 can form obvious plaque for SWU1. (C) M12 mutant strain and (D) M12_pNIT_Myc cannot form plaque.