Association of Mannose-Binding Lectin 2 Gene Polymorphism with Tuberculosis Based on Mycobacterium tuberculosis Lineages

Figures & data

Table 1 Primer Information for the Five Loci of the MBL2 Gene

SNP_ID	F/R	Base Sequence	Fragment Size (bp)	Annealing Temperature (°C)
rs1800450/ rs1800451	F	TCAAATAGGACATCAGTCTC	448	62
	R	GCAGTGTCACAAGGAATGTT
rs7096206/ rs7095891	F	AGGAGAAGGAGAGGGAGTGA	474	61.4
	R	TGGGATTCAGGTGGCAGATG
rs11003125	F	GAATCCCATCTTTGTATCTG	421	53.9
	R	AGGCTGCTGAGGTTTCTTAG

Table 2 Distributions of the MBL2 Genotypes and HWE Testing in the Control Group

SNP	Genotyping Rate* (%)	Genotype	Controls (n=147)		χ^2	P
			Actual Frequency	Theoretical Frequency
rs1800450	99.7	CC	98	100	0.820	0.664
		CT	46	43
		TT	3	5
rs1800451	99.7	CC	143	29	0.000	1.000
		CT	4	98
		TT	0	46
rs7096206	96.8	GG	6	3	1.045	0.593
		GC	37	40
		CC	98	96
rs7095891	96.8	GG	106	103	4.189	0.123
		GA	29	35
		AA	6	3
rs11003125	97.5	GG	39	42	1.131	0.568
		GC	75	69
		CC	25	28

Note: *The rate of the available genotyping samples to total samples.

Figure 1 The phylogeny tree.

Table 3 Association of MBL2 Gene Polymorphisms with Different Lineages of M. tuberculosis Infection

Factor	Lineage 2 (n/%)	Lineage 3 (n/%)	Lineage 4 (n/%)	Other Lineages (n/%)	χ^2	P^a
Age
<45	12 (35.3)	2 (25.0)	6 (27.3)	1 (25.0)	0.642	0.887
≥45	22 (64.7)	6 (75.0)	16 (72.7)	3 (75.0)
Gender
Male	18 (52.9)	4 (50.0)	9 (40.9)	1 (25.0)	1.660	0.646
Female	16 (47.1)	4 (50.0)	13 (59.1)	3 (75.0)
rs1800450
CC	25 (75.8)	6 (75.0)	16 (72.7)	4 (100.0)	2.326	0.508
CT	8 (24.2)	2 (25.0)	6 (27.3)	0 (0.0)
C	58 (87.9)	14 (87.5)	38 (86.4)	8 (100.0)	2.157	0.540
T	8 (12.1)	2 (12.5)	6 (13.6)	0 (0.0)
rs7096206
GG	1 (3.0)	0 (0.0)	0 (0.0)	1 (25.0)	8.402	0.210
GC	14 (42.4)	1 (12.5)	5 (25.0)	1 (25.0)
CC	18 (54.5)	7 (87.5)	15 (75.0)	2 (50.0)
G	16 (24.2)	1 (6.3)	5 (12.5)	3 (37.5)	5.966	0.113
C	50 (75.8)	15 (93.7)	35 (87.5)	5 (62.5)
rs7095891
GG	27 (81.8)	5 (62.5)	12 (60.0))	3 (75.0)	4.529	0.606
GA	5 (15.2)	3 (37.5)	7 (35.0)	1 (25.0)
AA	1 (3.0)	0 (0.0)	1 (5.0)	0 (0.0)
G	59 (89.4)	13 (81.3)	31 (77.5)	7 (87.5)	2.858	0.414
A	7 (10.6)	3 (18.7)	9 (22.5)	1 (12.5)
rs11003125
GG	9 (26.5)	0 (0.0)	9 (40.9)	1 (25.0)	8.834	0.183
GC	15 (44.1)	4 (50.0)	10 (45.5)	2 (50.0)
CC	10 (29.4)	4 (50.0)	3 (13.6)	1 (25.0)
G	33 (48.5)	4 (25.0)	28 (63.6)	4 (50.0)	7.530	0.057
C	35 (51.5)	12 (75.0)	16 (36.4)	4 (50.0)

Notes: Because rs1800451 only appeared in the CC genotype in each group, it was excluded from the analysis. ^aAcquired by Likelihood ratio chi-square test.

Table 4 Distributions of the Alleles of rs11003125 in MBL2 Gene Between Patients Infected with Lineages 3 and 4 of M. tuberculosis

SNP	Allele	Lineage 3 (n/%)	Lineage 4* (n/%)	χ^2	P	OR (95% CI)
rs11003125	G	4 (25.0)	28 (63.6)	7.037	0.008	1
	C	12 (75.0)	16 (36.4)			0.190 (0.053~0.690)

Note: *Lineage 4 was used as indicator, while lineage 3 was used as control.

Table 5 Univariate Regression Analysis of rs11003125 Polymorphisms and Lineages 4 of M. tuberculosis Infection

SNP	Genotype	Lineage 3 (n/%)	Lineage 4* (n/%)	P	OR (95% CI)
rs11003125	GC/GG	4 (50.0)	19 (86.4)	0.05	1
	CC	4 (50.0)	3 (13.6)		0.158 (0.025–0.999)

Note: *Lineage 4 was used as indicator, while lineage 3 was used as control.