Multiplex Digital PCR-Based Development and discussion of the Detection of Genetic Association Between Staphylococcus aureus and mecA

Figures & data

Figure 1 ddPCR detection flow diagram. (A)The lysostaphin-treated sample was dispersed by PCR reaction into 20,000 droplets containing target and background DNA. (B) Data output from a MDPCR experiment. The droplets form four clusters, arranged orthogonally to each other. Gray: empty droplet, negative for both targets; Purplish red: only Target A positive; Blue: only positive for Target B; Green: duplex-positive droplets.

Table 1 Primer and Probe Sequences

Name	Sequence	Target Sequence	Product Length (bp)
SAOUHSC_00106-F	TCAAACGGTTGGTGTGATAGGTT	TGGGATTGTTACTAGCGAATCATGTTATAGAACAAGACAGAAGGCAGTATGACCAAAGTTTTAAAATAGATAATGGTGATTTTTTGCAAGGGTCACCATTTTGTAATTACTTAATCGCGCATAGCGGCAGTAGCCAGCCTTTAGTTGATTTTTATAATCGAATGGCATTCGACTTTGGTACG	182
SAOUHSC_00106-R	TGCTCTGGTTGTTCCCAATG
SAOUHSC_00106-P	[5TAMRA]-AACGACACAATTTATTCC-[MGB]
mecA-F	AAAACTAGGTGTTGGTGAAGATATACC	GAAAGGATCTGTACTGGGTTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTAATAATATTTCATTATCTAAATTTTTGTTTGAAATTTGAGCATTATAAAATGGATAATCACTTGGTATATCTTCACCAACACCTAGTTTT	147
mecA-R	GAAAGGATCTGTACTGGGTTAATCAG
mecA-P	[6FAM]-TTCACCTTGTCCGTAACCTGAATCAGCT-[BHQ1]

Table 2 Comparison Table of the Concentration of Mixed Bacterial Solution

S. aureus	MRcoNS
11,760	60
11,760	70
11,760	84
11,760	105
11,760	140
11,760	210
11,760	840
11,760	1260
11,760	1680
11,760	2100
11,760	2520
11,760	2940

Figure 2 Primer amplification efficiency. (A) SAOUHSC_00106; (B) mecA.

Figure 3 Enzyme selection and optimization of reaction conditions. (A) The disparity in MRSA lysis between lysostaphin and lysozyme was assessed using qPCR.; (B) The disparity in enzyme concentration and cleavage efficacy remains consistent for the duration of the same action time (5 min). The symbols on the column represent differences with the first group, NS represents no difference, ** represents significant difference with the first group, **** represents significant difference with the first group and significant difference with the ** group. (C) Reaction time optimization, the test was performed in the presence of 10μg/mL lysostaphin. A: MRcoNS, reaction time 2min; B: MRcoNS, reaction time 5min; C: MRSA, reaction time 2min; D: MRSA, reaction time 5min; E: S. aureus, reaction time 2min; F: S. aureus, reaction time 5min.

Table 3 Validation of Specificity

Strain	P (x=3)	Results
Staphylococcus aureus	0	–
Methicillin-resistant Staphylococcus aureus	0.277086883	+
Methicillin-resistant coagulase-negative staphylococci	0	-
Staphylococcus warneri	0	-
Staphylococcus haemolyticus	0	-
Staphylococcus hominis	0	-
Staphylococcus cohnii	0	-

Notes: + was positive; - is negative.

Figure 4 The mixed bacterial solution of S. aureus and MRcoNS was utilized to validate the robustness of the protocol, with the X-axis representing the relative concentration of SAOUHSC_00106 signal and the Y-axis indicating the ratio of duplex-positive concentration to total signal.The circle (●) is the theoretical value, and the square (■) is the actual detection value.

Table 4 Differences in Results of ddPCR and Drug Susceptibility Testing Clinical Samples

Sample Types	Number of Samples	Results of ddPCR Assay	Results of Drug Susceptibility Testing
Pus	9	S. aureus:9	S. aureus:9
Swab	25	S. aureus:13 MRSA:12	S. aureus:15 MRSA:10
Sputum	36	S. aureus:20 MRSA:16	S. aureus:22 MRSA:14
Catheter	1	S. aureus:1	S. aureus:1
Ear secretion fluid	1	S. aureus:1	S. aureus:1

Figure 5 The results in 72 clinical samples were detected using single-bacterium MDPCR. The X-axis representing the relative concentration of SAOUHSC_00106 signal and the Y-axis indicating the ratio of duplex-positive concentration to total signal. The diamond (◆) is the theoretical value of the duplex-positive area, the circle (○) is the test result of MRSA samples, and the triangle (Δ) is the test result of S. aureus samples.

Figure 6 SMD-PCR, real-time fluorescence quantitative PCR and drug sensitivity detection of three detection schemes.