RAD21: A Key Transcriptional Regulator in the Development of Residual Liver Cancer

Figures & data

Table 1 The Sequences of RAD21 siRNA and qRT-PCR Primer

RNA Name	5’-3’ Sequences
RAD21-si-1	Forward GCCAUUACUUUACCUGAAGAATT
	Reverse UUCUUCAGGUAAAGUAAUGGCTT
RAD21-si-2	Forward GCUAAUUGUUGACAGUGUCAATT
	Reverse UUGACACUGUCAACAAUUAGCTT
RAD21-si-3	Forward GCUGAAUCUAUCAGUUUGCUUTT
	Reverse AAGCAAACUGAUAGAUUCAGCTT
NC	Forward UUCUCCGAACGUGUCACGUTT
	Reverse ACGUGACACGUUCGGAGAATT
RAD21 primer	Forward GGCACTGTTACCACAAACCTTTGG
	Reverse GGGGACATTTGAATGCTGACTGGC
GAPDH primer	Forward CAGGAGGCATTGCTGATGAT
	Reverse GAAGGCTGGGGCTCATTT

Figure 1 Screening of key transcriptional regulators of incomplete ablation residual HCC. (A) Volcano plot displaying differentially expressed genes in residual cancer tissue of MHCC97-H. (B) Volcano plot illustrating differentially expressed genes in residual cancer tissue of HepG2. (C) Overlapping Venn diagram showing upregulated genes and transcriptional regulatory factors based on HCC, HepG2 residual cancer, and MHCC97-H residual cancer. (D) Cox survival regression analysis of the OSrate in HCC patients. (E) Cox survival regression analysis of progression-free survival rate in HCC patients.

Figure 2 The expression pattern of RAD21 mRNA in a single data set was analyzed by globally multicentric microarrays and bulk RNA-seq data.

Figure 3 The expression pattern of RAD21 in liver cancer. (A) The random forest plot illustrates a significant overexpression of RAD21 in HCC. (B-E) Single-cell sequencing analysis reveals that RAD21 expression is primarily distributed in tumor cells. (E) Proteomics analysis demonstrates significantly higher levels of RAD21 protein in HCC compared to adjacent normal tissue. (F and G) The RAD21 staining in HCC tissues was observed under the microscope (x40, x100). (H and I) The RAD21 staining in HCC and liver tissues was observed under the microscope (x40, x100).

Table 2 Immunohistochemistry Shows the Expression of RAD21 in HCC and Adjacent Cancer and Its Relationship with Clinicopathological Parameters

Group	Total	Positive	Negative	χ2	p
Tissue
HCC	41	33	8	13.84	0.0002
Non-HCC	58	25	33
Age (year)
≤ 60	59	32	27	2.334	0.1266
> 60	28	20	8
Gender
Male	73	43	30	0.0116	0.9142
Female	26	15	11
Pathologic T
T1-T2	33	30	3	0.2975	0.5854
T3-T4	3	3	0

Table 3 The Relationship Exploration Based on Transcriptomics Between RAD21 Expression and HCC Clinicopathological Parameters

Group	N	Mean ± SD	p
Unpaired Tissue
HCC	371	5.723 ± 0.8792	< 0.0001^#
Non-HCC	50	4.512 ± 0.3592
Paired tissues
HCC	50	5.705 ± 0.8647	< 0.0001^#
Adjacent	50	4.512 ± 0.359
Age (year)
≤ 60	177	5.608 ± 0.818	0.0104^#
> 60	193	5.842 ± 0.9274
Gender
Male	250	5.747 ± 0.895	0.4483
Female	121	5.673 ± 0.8469
Vascular invasion
No	206	5.625 ± 0.8929	0.1687
Yes	109	5.770 ± 0.8881
Clinical stage
I/II	257	5.662 ± 0.8820	0.0446^#
III/IV	90	5.880 ± 0.8842
Grade
G1/G2	232	5.567 ± 0.8604	< 0.0001^#
G3/G4	134	5.988 ± 0.8551
Pathologic T
T1/T2	275	5.668 ± 0.8705	0.0268^#
T3/T4	93	5.902 ± 0.8934
Pathologic N
N0	252	5.763 ± 0.8705	0.5238
N1	4	6.043 ± 0.8216
Pathologic M
M0	266	5.734 ± 0.8975	0.5266
M1	4	5.448 ± 0.7323

Note: ^#Indicates the statistically significant.

Table 4 The Relationship Exploration Based on the Proteomics Between RAD21 Protein Expression and HCC Clinicopathological Parameters

Group	N	Mean ± SD	p
Paired tissues
HCC	165	0.1870 ± 0.3032	< 0.0001^#
Adjacent	165	− 0.1979 ± 0.1462
Age (year)
≤ 60	115	0.2027 ± 0.3230	0.2492
> 60	44	0.1401 ± 0.2541
Gender
Male	128	0.1832 ± 0.2959	0.8530
Female	31	0.1946 ± 0.3499
Tumor thrombus
No	122	0.1436 ± 0.2985	0.0016^#
Yes	37	0.3231 ± 0.2934
Tumor encapsulation
No	45	0.2387 ± 0.3177	0.1846
Yes	110	0.1660 ± 0.3044
Grade
G1/G2	95	0.1148 ± 0.2941	0.0002^#
G3	63	0.2988 ± 0.2894
Size(cm)
≤ 5	77	0.1754 ± 0.3132	0.6905
> 5	82	0.1948 ± 0.300

Note: ^#Indicates the statistically significant.

Figure 4 Diagnostic and survival significance of RAD21 in HCC. The sROC curves. (A) The value of RAD21 in distinguishing HCC and non-tumor livers; an indication of OS (B) and PFS (C) based on RAD21 mRNA levels in HCC based on RNA-seq data; an indication of OS (D) and PFS (E) based on RAD21 protein levels in HCC using proteomics data.

Figure 5 RAD21 level related to the inhibitory immune checkpoints and ICB response. (A) The expression of CD274, CTLA4, HAVCR2, PDCD1, and TIGIT is relatively increased in the high expression group of RAD21. (B) TIDE scores predict a low potential response to immunotherapy in the RAD21 highly expressed group. Note: * indicates p< 0.05, *** indicates p< 0.001, and **** indicates p< 0.0001.

Figure 6 RAD21 mRNA and protein levels after liver cancer cells transfected with siRNA. RAD21 mRNA levels in Huh7 (A) and Hep3B (D) cells after siRNA transfection; RAD21 protein levels in Huh7 (B and C) and Hep3B (E and F) cells after siRNA transfection. Note: *** indicates p< 0.001, and **** indicates p< 0.0001.

Figure 7 Effect of RAD21 knockdown on migration and proliferation of liver cancer cells. Cell scratch assays detected a decreased migration capability of Hep3B (A and B) and Huh7 (D and E) cells after RAD21 knockdown; CCK-8 assays detected a decreased proliferation capability of Hep3B (C) and Huh7 (F) cells after RAD21 knockdown. Note: *** indicates p< 0.001, and **** indicates p< 0.0001.

Figure 8 Effect of RAD21 knockdown on migration and invasion of liver cancer cells. Transwell migration and invasion assays detected decreased migration and invasion capabilities of Hep3B (A and B) and Huh7 (C and D) cells after RAD21 knockdown. Note: **** indicates p< 0.0001.

Figure 9 Alteration of RAD21 expression and biological behaviors in heat-treated liver cancer cells. Transwell assays detected enhanced migration and invasion capabilities of Hep3B (A and B) and Huh7 (D and E) cells after heat treatment; CCK-8 experiments detected increased proliferation capability of Hep3B (C) and Huh7 (F) cells after heat treatment; (G–J) RT-qPCR and WB detected increased RAD21 mRNA and protein in liver cancer cells after heat treatment. Note: ** indicates p< 0.01, *** indicates p< 0.001, and **** indicates p< 0.0001.

Figure 10 Downstream targets of RAD21 and Gene Ontology and KEGG pathway analysis in residual cancer. (A) Overlapped genes between RAD21 targets and upregulated genes in residual HCC and HCC. Gene Ontology (B), KEGG (C), WikiPathways (D), Panther (E), and Reactome (F) pathway analysis for the targets of overlapped genes.