The Potential of the lncRNAs ADAMTSL4-AS1, AC067931 and SOCS2-AS1 in Peripheral Blood Mononuclear Cells as Novel Diagnostic Biomarkers for Hepatitis B Virus-Associated Hepatocellular Carcinoma

Figures & data

Table 1 Primer Sequences of the qRT-PCR Used in This Study

lncRNA Name	Forward Primer(5’ to 3’)	Reverse Primer(5’ to 3’)
ADAMTSL4-AS1	AGTCTCTTTCCTCCTGCCTTCCTG	TCTAAGCCGCCCTGTGTCTCTG
AC067931	AGTCTCTTTCCTCCTGCCTTCCTG	TCTAAGCCGCCCTGTGTCTCTG
SOCS2-AS1	TCCAGTCCTGTTTCTAGGGCTTCC	CGAACTCCTGACCTCAAGTGCTTC
AL731577	CCTGCCTGACACAGCTCACTTC	TTGGGCACGACACATAGTACACTTG
TPM1-AS	ACGCACAGACACGACTGAAAGC	GTGGTGTTGAGAAGGTTCTGGAAGG
AL356356	TCACCACCTGTGCTGTCTCCTG	CACGCTGTCCTTTCGCTGAGTC
AC037198	CAAACGCTGGGGTGAGAGGAAC	GTCATTTCTGTCAGGGGAGCCATAC
AL161773	CCTGCTTGCTGTATCTGCGTCTG	TGTCGTCACTGAGAGTCCTGGATG
AP002026	AACCAAGGCACCAATCCCAACTG	CTAGGAAGGGCAACAACCAAGTGAG
β-actin	AAAGCGGCTGTTAGTCACTGG	CGAGTCATTGCATACTGTCCAT

Figure 1 Bioinformatics analysis of transcriptomics data. (A) Clustering Heatmap of DELs among CHB, LF/LC and HCC tissues. The columns represented the clinical liver samples, and the rows indicated as DELs. Blue and red indicate down- and up-regulation, respectively. (B) Venn diagram showing the differential expression level of each lncRNA of the three comparison groups. Volcano plots for DELs between CHB and HCC (C) as well as LF/LC and HCC (D) groups. The red points indicated up-regulated lncRNAs, while the blue points represented down-regulated lncRNAs. The grey points represented non-significant differently expressed lncRNAs. (E and F) GO enrichment and KEGG pathway analyses of the identified lncRNAs. The depth of color and size of black spots denote the adjusted p-value and lncRNA quantities, respectively.

Abbreviations: DELs, differentially expressed lncRNAs; CHB, chronic hepatitis B; LF, liver fibrosis; LC, liver cirrhosis; HCC, hepatocellular carcinoma; lncRNA, long non-coding RNA; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Table 2 Clinical and Laboratory Characteristics of the Paticipants

Variables	CHB	LC	HCC	F/Z/X2	P
	(N=49)	(N=44)	(N=56)
Age(years)	41.4±9.8	52.5±11.4*	56.5±9.6*	44.512	<0.001
Gender(male), n(%)	35(71.4)	33(75)	48(81.4)	1.396	0.498
AFP(ng/mL)	3.3 (2.1–4.9)	2.9 (1.8–5.6)	14.2 (3.2–421.8)*^#	30.011	<0.001
HBsAg(log10 IU/mL)	3.4(2.8–3.8)	3.0(2.8–3.1)*	3.0(2.5–3.2)*	11.047	0.004
HBeAg	0.7(0.4–9.5)	0.6(0.0–3.8)	0.5(0.0–1.1)*	7.928	0.019
HBVDNA(log10 IU/mL)	1.3(1.3–1.4)	1.3(1.3–1.3)	2.4(1.3–5.0)*^#	22.331	<0.001
RBC(10^12/L)	4.6±0.5	3.5±1.0*	3.9±0.7*	38.267	<0.001
HGB(g/L)	144.0(130.6–153.0)	101.5(79.3–140.5)*	128.0(104.0–135.0)*	34.407	<0.001
WBC(10^9/L)	5.3(4.2–6.5)	3.5(1.9–5.0)*	4.6(3.5–6.5)^#	15.595	<0.001
PLT(10^9/L)	197.0(154.3–235.4)	70.5(44.3–103.3)*	115.0(65.0–150.0)*^#	61.588	<0.001
INR	1.1(1.0–1.1)	1.3(1.2–1.7)*	1.2(1.1–1.3)*^#	50.548	<0.001
PT(s)	12.0(11.2–12.8)	16,4(14.0–19.5)*	13.6(12.5–14.9)*^#	61.751	<0.001
ALT(U/L)	22.0(16.5–37.5)	24.0(14.0–32.8)	41.3(25.0–73.0)*^#	18.339	<0.001
AST(U/L)	20.0(18.0–28.5)	31.0(22.8–38.5)*	39.0(29.5–101.0)*^#	41.463	<0.001
ALP(U/L)	75.0(62.5–85.0)	70.0(54.0–101.5)	118.0(85.0–185.0)*^#	38.257	<0.001
GGT(U/L)	26.0(17.0–36.0)	30.0(14.5–54.0)	73.0(33.4–235.0)*^#	31.588	<0.001
TBIL(μmol/L)	15.9(11.2–20.2)	32.2(16.0–50.5)*	20.4(12.9–33.5)*^#	23.846	<0.001
DBIL(μmol/L)	4.1(3.0–5.1)	10.2(5.8–30.3)*	9.3(5.2–18.5)*	48.538	<0.001
TP(g/L)	73.9(70.7–76.7)	63.4(54.8–70.6)*	67.1(61.9–74.7)*^#	32.694	<0.001
ALB(g/L)	46.7(44.0–48.8)	37.6(33.5–43.3)*	36.3(32.0–40.5)*	59.000	<0.001
CEA(ng/mL)	1.7(1.1–2.5)	2.9(1.7–4.4)*	3.1(1.8–4.3)*	25.349	<0.001
CA199(U/mL)	13.1(5.5–15.8)	18.2(10.6–34.8)*	39.8(20.6–92.1)*^#	34.645	<0.001
CA125(U/mL)	11.2(8.9–14.2)	21.1(16.2–33.3)*	32.4(12.0–151.5)*	33.798	<0.001

Notes: Date are presented as means(SD) or median(interquartile range) or percentage. *P<0.05 vs chronic hepatitis B; ^#P<0.05 vs liver cirrhosis.

Abbreviations: CHB; chronic hepatitis B; LC, liver cirrhosis; HCC, hepatocellular carcinoma; AFP, alpha fetoprotein; HBsAg, hepatitis B surface antigen; HBeAg, hepatitis B e antigen; HBVDNA, hepatitis B virus deoxyribonucleic acid; RBC, red blood cell; HGB, hemoglobin; WBC, white blood cell; PLT, platelet; INR, international normalized ratio; PT, prothrombin time; ALT, alanine aminotransferase; AST, aspartate aminotransferase; ALP, alkaline phosphatase; GGT, gamma-glutamyl transferase; TBIL, total bilirubin; DBIL, direct bilirubin; TP, total protein; ALB, albumin; CEA, carcinoembryonic antigen; CA199, carbohydrate antigen 199; CA125, carbohydrate antigen 125.

Figure 2 The relative expression profile of the selected lncRNAs in CHB patients, HBV-associated LC patients, and HBV-associated HCC patients. Relative lncRNA expression levels in PBMC samples were detected by qRT-PCR. (A) ADAMTSL4-AS1, (B) AC067931, (C) SOCS2-AS1, (D) AL731577, (E) TPM-AS, (F) AL356356, (G) AC037198, (H) AP002026. The expression levels of related lncRNAs in liver tissues were detected by qRT-PCR. (I) ADAMTSL4-AS1, (J) AC067931, (K) SOCS2-AS1, (L) AL731577. Relative expression levels of lncRNAs were upregulated in four human HCC cells(Huh7, HepG2, Hep3B, HepG2.215) comparison with Lx2 cells determining by qRT-PCR. (M) ADAMTSL4-AS1, (N) AC067931, (O) SOCS2-AS1. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Table 3 Correlation of Clinicopathological Variables with the Expression of ADAMTSL4-AS1, AC067931 and SOCS2-AS1 in PBMCs from HBV-Associated HCC Patients

Variables	N	ADAMTSL4-AS1		P	AC067931		P	SOCS2-AS1		P
		Low	High		Low	High		Low	High
Age
≤50y	12	6	6	1.000	7	5	0.515	7	5	0.515
>50y	44	22	22		21	23		21	23
Gender
Male	47	25	22	0.467	24	23	1.000	23	24	1.000
Female	9	3	6		4	5		5	4
AFP
>7ng/mL	35	16	19	0.408	18	17	0.783	16	19	0.408
≤7ng/mL	21	12	9		10	11		12	9
Tumor size
>5cm	21	11	10	0.783	11	10	0.830	12	10	0.584
≤5cm	35	17	18		16	18		16	18
Clinical stage
I-II	28	13	15	0.593	10	18	0.033	12	16	0.285
III-IV	28	15	13		18	10		16	12
Vascular invasion
Yes	22	11	11	1.000	13	9	0.274	14	8	0.011
No	34	17	17		15	19		14	20
Tumor number
=1	22	10	12	0.584	10	12	0.584	10	12	0.584
>1	34	18	16		18	16		18	16
Lymph node metastasis
Yes	5	2	3	1.000	3	2	1.000	3	2	1.000
No	51	26	25		25	26		25	26
Distant metastasis
Yes	4	1	3	0.604	1	3	0.604	2	3	0.656
No	52	27	25		27	25		26	26

Abbreviation: AFP, alpha fetoprotein.

Table 4 Differential Diagnostic Efficacy of PBMC ADAMTSL4-AS1, AC067931, SOCS2-AS1, AFP, the Combined and the Combined+AFP

Group	Marker	AUC	P value	95% CI	SEN(%)	SPE(%)
HCC vs CHB	ADAMTSL4-AS1	0.833	<0.001	0.747–0.898	92.9	61.2
	AC067931	0.819	<0.001	0.732–0.887	92.9	61.2
	SOCS2-AS1	0.841	<0.001	0.757–0.905	91.1	65.3
	AFP	0.769	<0.001	0.676–0.845	55.4	98
	Combined	0.865	<0.001	0.785–0.924	94.6	63.3
	Combined+AFP	0.945	<0.001	0.883–0.980	83.9	89.8
HCC vs LC	ADAMTSL4-AS1	0.752	<0.001	0.656–0.833	80.4	65.9
	AC067931	0.761	<0.001	0.665–0.840	76.8	72.7
	SOCS2-AS1	0.757	<0.001	0.661–0.837	98.2	63.6
	AFP	0.783	<0.001	0.690–0860	58.9	90.9
	Combined	0.762	<0.001	0.666–0.841	69.6	75.0
	Combined+AFP	0.871	<0.001	0.789–0.929	91.1	68.2
HCC vs CHB+LC	ADAMTSL4-AS1	0.795	<0.001	0.721–0.856	80.4	68.8
	AC067931	0.791	<0.001	0.717–0.853	76.8	71.0
	SOCS2-AS1	0.802	<0.001	0.729–0.862	91.1	64.5
	AFP	0.776	<0.001	0.700–0.840	58.9	91.4
	Combined	0.813	<0.001	0.741–0.872	75.0	72.0
	Combined+AFP	0.905	<0.001	0.846–0.947	91.1	75.3

Abbreviations: AFP, alpha fetoprotein. CHB; chronic hepatitis B; LC, liver cirrhosis; HCC, hepatocellular carcinoma; AUC, area under the curve; CI, confidence interval; SEN, sensitivity; SPE, specificity.

Figure 3 Area under receiver operating characteristic curves (AUROCs) of lncRNAs and AFP for differentiating the HBV-related HCC group from the HBV-associated with non-HCC groups. (A) HCC from CHB (B) HCC from LC (C) HCC from CHB+LC. ROC curve analysis for the individual lncRNAs or AFP or their combinations in the diagnosis of (D) AFP negative HCC patients, (E) small HCC patients and (F) early-stage HCC patients from CHB+LC.

Table 5 Diagnostic Efficacy of Individual PBMC lncRNAs or AFP or Their Combinations in AFP(-), Small, and Early-Stage HCC Patients

Group	Marker	AUC	P value	95% CI	SEN(%)	SPE(%)
AFP (-) HCC vs CHB+LC	ADAMTSL4-AS1	0.800	<0.001	0.715–0.869	100	54.8
	AC067931	0.797	<0.001	0.712–0.867	100	53.8
	SOCS2-AS1	0.795	<0.001	0.709–0.865	90.5	64.5
	AFP	0.570	0.2508	0.474–0.662	85.7	34.4
	Combined	0.825	<0.001	0.743–0.890	100	59.1
	Combined+AFP	0.814	<0.001	0.730–0.881	90.5	66.7
Small HCC vs CHB +LC	ADAMTSL4-AS1	0.797	<0.001	0.716–0.863	80.0	68.8
	AC067931	0.794	<0.001	0.714–0.861	77.1	71.0
	SOCS2-AS1	0.819	<0.001	0.742–0.882	94.3	64.5
	AFP	0.736	<0.001	0.651–0.810	60.0	87.1
	Combined	0.833	<0.001	0.757–0.893	77.1	75.3
	Combined+AFP	0.909	<0.001	0.845–0.952	91.4	74.2
Stage (I + II) HCC vs CHB + LC	ADAMTSL4-AS1	0.820	<0.001	0.740–0.884	85.7	68.8
	AC067931	0.831	<0.001	0.752–0.893	85.7	71.0
	SOCS2-AS1	0.825	<0.001	0.745–0.888	92.9	64.5
	AFP	0.685	0.0060	0.594–0.766	53.6	91.4
	Combined	0.831	<0.001	0.752–0.893	96.4	55.9
	Combined+AFP	0.863	<0.001	0.789–0.919	67.9	90.3

Abbreviations: AFP, alpha fetoprotein. CHB; chronic hepatitis B; LC, liver cirrhosis; HCC, hepatocellular carcinoma; AUC, area under the curve; CI, confidence interval; SEN, sensitivity; SPE, specificity.