The effects of adenosine A_2B receptor inhibition on VEGF and nitric oxide axis-mediated renal function in diabetic nephropathy

Figures & data

Table 1. Allocation of treatment to animals.

Groups	Group I (n = 6)	Group II (n = 6)	Group III (n = 6)	Group IV (n = 6)
Treatment	Vehicle (Sodium citrate buffer)	Streptozotocin +Vehicle of MRS1754 (for two weeks corresponding to group III)	Streptozotocin+ MRS1754	MRS1754

Table 2. Sequences of primer used in real time PCR.

	Primers
Entity	Sense sequence	Antisense sequence
VEGF	GTTCACTGTGAGCCTTGTTCAG	GTCACATCTGCAAGTACGTTCG
GAPDH	TTCACCACCATGGAGAAGGC	GGCATGGACTGTGGTCATGA
A2B receptor	TTGGCATTGGATTGACTC	TATGAGCAGTGGAGGAAG

Figure 1. Effect of A_2B adenosine receptor antagonist (MRS1754) on (a) Blood Glucose; (b) Kidney weight/body weight; (c) Food intake; (d) Body weight in control and diabetic animals. Notes: Data are means (±SEM). *p < 0.05 versus control group #p < 0.05 versus diabetes group; n = 6.

Figure 2. Effect of A_2B adenosine receptor antagonist (MRS1754) on the renal functions in control and diabetic animals. (a) Serum creatinine; (b) Blood urea nitrogen; (c) Creatinine clearance; (d) Urinary albumin excretion. Results shown are the means ( ± SEM). Notes: *p < 0.05; #p < 0.05 versus Diabetes group; n = 6.

Figure 3. Real-time RT-PCR analysis of (a) A_2B adenosine receptors and (b) VEGF mRNA level in kidney. RNA was isolated reverse-transcribed to cDNA, as described. The cDNA was then subjected to real-time PCR using specific primers and expression levels calculated and normalized to an internal control (GAPDH). (c) Correlation between expressions of both the genes (Pearson’s correlation). Notes: Data are means (±SEM). *p < 0.05 versus control group; #p < 0.05 versus diabetes group. n = 5.

Figure 4. Effect of A_2B adenosine receptor antagonist (MRS1754) on (a) plasma; (b) homogenate concentration of VEGF protein, measured by ELISA in different experimental groups. Notes: Data are means (±SEM). *p < 0.05 versus control group; #p < 0.05 versus diabetes group, n = 6.

Figure 5. A_2B adenosine receptor antagonist (MRS1754) on (a) kidney tissue (b) urine nitrite levels in control and diabetic mice. Notes: Data are means (±SEM). *p < 0.05 versus control group; #p < 0.05 versus diabetes group; n = 6.

Figure 6. Masson trichrome staining of kidney tissue: (a) Control; (b) Diabetes; (c) Diabetes + MRS1754; (d) Control MRS1754. All images are representative glomeruli at an original magnification of 400×.

Figure 7. Glomerulosclerosis score in different experimental groups. Notes: Data are means (±SEM). *p < 0.05 versus control group; #p < 0.05 versus diabetes group; n = 6.

Figure 8. Effect of A_2B adenosine receptor antagonist (MRS1754) on relative VEGF level in kidney tissue in different experimental groups. Notes: Data are means (±SEM). *p < 0.05 versus control group; #p < 0.05 versus diabetes group; n = 6.