Effects of nanoselenium supplementation on lactation performance, nutrient digestion and mammary gland development in dairy cows

Abstract

The objective of this experiment was to evaluate the influence of nanoselenium (NANO-Se) addition on milk production, milk fatty acid synthesis, the development and metabolism regulation of mammary gland in dairy cows. Forty-eight Holstein dairy cows averaging 720 ± 16.8 kg of body weight, 66.9 ± 3.84 d in milk (dry matter intake [DIM]) and 35.2 ± 1.66 kg/d of milk production were divided into four treatments blocked by DIM and milk yields. Treatments were control group, low-Se (LSe), medium-Se (MSe) and high-Se (HSe) with 0, 0.1, 0.2 and 0.3 mg Se, respectively, from NANO-Se per kg dietary dry matter (DM). Production of energy- and fat-corrected milk (FCM) and milk fat quadratically increased (p < 0.05), while milk lactose yields linearly increased (p < 0.05) with increasing NANO-Se addition. The proportion of saturated fatty acids (SFAs) linearly decreased (p < 0.05), while proportions of monounsaturated fatty acids (MUFAs) linearly increased and polyunsaturated fatty acids (PUFAs) quadratically increased. The digestibility of dietary DM, organic matter (OM), crude protein (CP), neutral detergent fiber (NDF) and acid detergent fiber (ADF) quadratically increased (p < 0.05). Ruminal pH quadratically decreased (p < 0.01), while total VFA linearly increased (p < 0.05) with increasing NANO-Se addition. The acetic to propionic ratio decreased (p < 0.05) linearly due to the unaltered acetic molar percentage and a quadratical increase in propionic molar percentage. The activity of CMCase, xylanase, cellobiase and pectinase increased linearly (p < 0.05) following NANO-Se addition. The activity of α-amylase increased linearly (p < 0.01) with an increase in NANO-Se dosage. Blood glucose, total protein, estradiol, prolactin, IGF-1 and Se linearly increased (p < 0.05), while urea nitrogen concentration quadratically decreased (p = 0.04). Moreover, the addition of Se at 0.3 mg/kg from NANO-Se promoted (p < 0.05) mRNA and protein expression of PPARγ, SREBP1, ACACA, FASN, SCD, CCNA2, CCND1, PCNA, Bcl-2 and the ratios of p-ACACA/ACACA and BCL2/BAX4, but decreased (p < 0.05) mRNA and protein expressions of Bax, Caspase-3 and Caspase-9. The results suggest that milk production and milk fat synthesis increased by NANO-Se addition by stimulating rumen fermentation, nutrients digestion, gene and protein expressions concerned with milk fat synthesis and mammary gland development.

Keywords:

• Lactation performance
• nanoselenium
• mammary gland development
• milk fat synthesis
• nutrient digestibility

Introduction

The primary goal in dairy industry development is the production of healthy heifers with normal mammary glands that can synthesize and secrete large quantities of high-quality milk.¹ However, the proliferation of mammary epithelial cells is impacted by many factors, including nutrition,² hormones³ and environment.⁴

Selenium (Se) is an essential element for the normal growth, development and health of dairy cows and plays a crucial role in many metabolic functions of tissues and organs because of its antioxidant capability.^5,6 Se is required for the synthesis of many Se-dependent enzymes, containing glutathione peroxidase (GSH-Px), selenoprotein-P, thioredoxin reductase and thioredoxin. These enzymes regulate the intracellular inflammatory and apoptotic signal cascades to preserve the intracellular environment.^7,8 Numerous studies have emphasized the link established between Se and the performance of dairy cows. Supplementation with Se has been shown to increase the production of milk^9–11 and milk fat and protein,¹² increase nutrient digestibility,^11,12 ruminal total volatile fatty acid (VFA) concentration and microbial enzymatic activity.^9,11 Supplementation with Se decrease mastitis and embryonic mortality.^5,13 Se plays a role in adjusting the cell proliferation and apoptosis in relation to several protein kinases and intracellular signaling pathways.¹⁴ Recently, the addition of Se has been shown to promote the proliferation of lens epithelial cells, following ultra-violet B-induced damage⁶, and of spermatogonial stem cells of sheep.¹⁵ Furthermore, Zhang et al. demonstrated that supplementation of 50 nmol/L of Se in cell culture fluid increased cell viability and relative growth rate of bovine mammary epithelial cells (BMECs).¹⁶

As a new way of supplementing Se, nanoselenium (NANO-Se, typically 20–60 nm) that uses a protein as a dispersant and the element Se as a membrane, has more active centers, higher biological activity and less toxicity than those of other Se supplements (selenite and selenate) and can increase the expressions of Se-containing proteins more effectively.¹⁷ Dietary NANO-Se addition is more effective than sodium selenite in increasing the Se concentration and GSH-Px activities in milk and blood and upregulating the mammary mRNA expression levels of GSH-Px.¹⁸ Accordingly, we hypothesized that supplementation with NANO-Se could enhance the lactation performance and milk fatty acid synthesis by stimulating mammary gland development. Furthermore, we sought to clarify the regulatory mechanism underlying the effect of NANO-Se addition on mammary gland development by quantifying the expressions of the genes and proteins involved in fatty acid synthesis and mammary gland cell proliferation. Our study sought to investigate the impacts of NANO-Se addition on the lactation performance, nutrient digestion, expressions of genes and proteins involved in milk fatty acid synthesis, and cell proliferation of the mammary gland in dairy cows.

Materials and methods

The research proposal of the current investigation was evaluated and authorized by the Shanxi Agriculture University Animal Care and Use Committee (Taigu, China) before the study commencement (IACUC Issue No. SXAU-EAW-2021C.FU.00301401).

Holstein cows, experimental design and diets

A randomized block design experiment was performed with 48 multiparous Holstein dairy cows (720 ± 16.8 kg body weight, 66.9 ± 3.84 d in milk and 35.2 ± 1.66 kg/d milk yield) at the beginning of the study. The feeding experiment was conducted for 120 days, comprising a 15-d covariate period followed by a 15-d adaptation period and a subsequent 90-d sampling period. The production data collected during the covariate period were used to formulate a basal diet (Table 1). The diet was formulated based on the NRC recommendations.¹⁹ Cows were blocked by days in milk and milk yield during the covariate period and divided into one of four groups in a randomized block design. The groups included a control group (without NANO-Se) and low-Se (LSe), medium-Se (MSe) and high-Se (HSe) treatment groups with 0, 0.1, 0.3 and 0.5 mg Se, respectively, from NANO-Se per kg dietary dry matter (DM). The amount of Se added was based on a previous study,¹⁸ in which it was found that 0.3 mg of Se from NANO-Se per kg dietary DM has an influence on dry matter intake (DMI). The NANO-Se additive (feed grade, 995 g/kg Se; Sichuan Jilongda Biotechnology Group Co. LTD., Guanghan, China) was blended into the basal diet (Table 1). The basal diet and NANO-Se additive were mixed as a total mixed ratio (TMR) twice daily. Cows were housed in a naturally ventilated, two-row, head-to-head, free-stall barn equipped with a Calan gate Feeding System for monitoring individual intake and were milked three times (at 05:30, 13:30 and 20:30 h) per day, fed the same standard diet ad libitum, and had free access to water.

Table 1. Ingredients and chemical composition of the basal diet (DM basis).

Item	Contents (%)
Ingredients
Corn fodder silage	25.5
Alfalfa hay	11.8
Oat hay	12.7
Corn grain, ground	25.4
Wheat bran	6.00
Soybean meal	9.20
Rapeseed meal	2.50
Cottonseed cake	5.10
Calcium carbonate	0.50
Salt	0.50
Dicalcium phosphate	0.30
Mineral and vitamin premix^a	0.50
Chemical composition
Organic matter	94.6
Crude protein (CP)	16.6
Ether extract (EE)	3.27
Neutral detergent fiber (NDF)	31.5
Acid detergent fiber (ADF)	19.3
Non-fiber carbohydrate^b	43.3
Calcium	0.72
Phosphorus	0.45
NEL^c, MJ/kg	6.56

^aPer kg premix: 20,000 mg Fe, 1600 mg Cu, 8000 mg Mn, 7122 mg Zn, 120 mg I, 60 mg Se, 20 mg Co, 820,000 IU vitamin A, 300,000 IU vitamin D and 10,000 IU vitamin E.

^bNon-fiber carbohydrate (NFC), calculated by 1000-CP-NDF-EE-Ash.

^cNet energy for lactation (NE_L) was estimated based on NRC.¹⁹

Data and sample collection

Cows were weighed on two consecutive days at 16:00 h on day 1 of the covariate period and on days 1 and 90 of the sampling period. The provided TMR and the refused TMR were determined daily for each dairy cow during the entire study to estimate the DMI. Samples were collected every 5 d of the covariate period and every 10 d during the sampling period and were stored at −20 °C. Milk production was measured daily for each cow during the entire experiment. Milk samples were collected from each cow every 5 d of the covariate period and every 10 d during the sampling period from each milking on three consecutive milkings within a day. Concurrently, samples were collected and stored at 4 °C with 2-bromo-2-nitropropane-1, 3-diol. At 06:30 and 18:30 h during days 1–15 of the covariate period and days 70–87 of the sampling period, all cows were dosed with 5 g of chromic oxide powder placed in a gelatin capsule to serve as a digestion marker. Approximately, 250 g of fecal samples were collected from each cow’s rectum at 07:00, 13:00, 19:00 and 01:00 h during days 8–15 of the covariate period and days 78–87 of the sampling period and stored at −20 °C. During days 88–89, samples of TMR, refusals, and feces of each cow were composited, dried at 55 °C for 72 h, and ground to pass through a 1-mm screen with a cutter mill (Beishengwei Experimental Instrument, Changzhou, China).

Ruminal fluid was collected from each animal via an oral stomach tube at before the morning feeding, and 3, 6 and 9 hours after feeding on day 5 of the covariate period and days 44 and 89 of the sampling period. The initial 150 mL of ruminal fluid was discarded to minimize saliva contamination, and the next 200 mL was reserved and filtered through four layers of medical gauze. The ruminal pH of each cow was determined once using a portable pH meter (ST3100/F; Zhejiang Scientific Equipment, Zhejiang, China). Thereafter, 5 mL of the filtrate was mixed with 1 mL of 250 g/L of meta-phosphoric acid before being stored at −20 °C for VFA analysis. Furthermore, 5 mL of the filtrate was mixed with 1 mL of 20 g/L sulfuric acid before being stored at −20 °C for the analysis of ammoniacal nitrogen. For microbial enzymatic activity analyses, 50 mL of the filtrate was frozen in liquid nitrogen and subsequently stored at −80 °C.

At 10:30 h on day 15 of the covariate period and day 90 of the sampling period, blood samples from each dairy cow were collected into 10-mL evacuated tubes (serum separation gel coagulant tube, Hunan Liuyang Medical Instrument, Liuyang, China) via the coccygeal vessel. Blood samples were promptly placed on ice and transported to the laboratory to separate the serum by centrifugation at 2000 × g and 4 °C for 12 min, whereafter the serum samples were stored at −20 °C.

Mammary tissue biopsies were performed from 16:00 to 20:00 h on day 15 of the covariate period and day 90 of the sampling period. Approximately, 1 g of mammary gland secretory tissue was collected by surgical biopsy from the midpoint section of the rear quarter²⁰ and was rapidly frozen in liquid nitrogen and kept at −80 °C for total RNA extraction.

Chemical analyses

The contents of DM, nitrogen, ether extract, and crude ash in TMR, refusal and feces samples were measured as described in AOAC.²¹ The organic matter (OM) content was estimated as the difference between the DM and crude ash contents. The neutral detergent fiber (NDF) content was determined as previously described using heat-stable alpha-amylase and sodium sulfite and expressed including residual ash.²² The acid detergent fiber (ADF) content was analysed as described in AOAC.²¹ The fat, true protein, and lactose contents of the milk were analysed as described in AOAC (method 972.16).²¹ Milk fat extraction and trans-methylation of the esterified FA were performed as described in a previous report.²³ Fatty acid methyl esters (FAMEs) were used for gas chromatographic measurement of the fatty acid composition in milk (Agilent 7890 A, Agilent Technologies, Santa Clara, CA). FAMEs were identified by comparisons with retention times of the standards: FAME Mix C4-C24 Unsaturates (Sigma, Roedermark, Germany), methyl trans-11 C18:1 (Sigma), and methyl cis-9 and trans-11 CLA (Matreya1255, Pleasant Gap). According to the method of Rico and Harvatine,²⁴ the mean proportion of FA in total milk lipids was calculated for each sample. The chromium content of the feces was measured using atomic absorption spectrophotometry (AA-1800H; Shanghai Meisei Instrument Co., LTD., Shanghai, China) as described by Williams et al.²⁵ Ruminal VFA concentrations were analysed using gas chromatography (GC-7890; Agilent Technology, Beijing, China). The ammoniacal nitrogen content was analysed according to the procedure of AOAC.²¹ The microbial enzyme activities of ruminal fluid (cellobiose, carboxymethyl cellulase [CMCase], α-amylase, xylanase, pectinase and protease) were determined as described by Agarwal et al.²⁶ Biochemical kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) for glucose (no. A154-2-1), total protein (A045-3-1), albumin (no. A028-1-1), urea nitrogen (no. C013-2-1) and triglyceride (no. A110-2-1) were used to analyse the serum concentrations of glucose, total protein, albumin, urea nitrogen and triglycerides using an Automatic Biochemical Analyzer (BS-400, Nanjing Badeng Co., LTD, Nanjing, China). ELISA kits (Beijing Biolide Biotechnology Co., LTD, Beijing, China) for bovine estradiol (bovine, no. BL-E28820M), prolactin (bovine, no. BL-E28845M) and insulin-like growth factor 1 (IGF-1; bovine, no. BL-E21687M) were used to analyse E2, prolactin and IGF-1 with a Konelab autoanalyzer (Thermo Fisher Scientific Oy, Vantaa, Finland). Levels of Se in feed, milk and serum were determined as described by Webb et al.²⁷

Extraction of mammary gland RNA and real-time PCR

Total RNA was isolated from 100 mg of mammary gland tissue using a total RNA extraction kit (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. The concentration and quality of the extracted RNA were measured on a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). For all preparations, the ratio of absorbance at 260 and 280 nm was close to 2.0. Denaturing agarose gel electrophoresis and ethidium bromide staining were used to evaluate RNA integrity. cDNA was synthesized using 500 ng of total RNA from each sample per 10 µL of the sample reaction mixture using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories GmbH, Munich, Germany) according to the manufacturer’s specifications. Reactions were conducted at 37 °C for 15 min and 85 °C for 5 min. To identify possible genomic or environmental DNA contamination, a negative control reaction without reverse transcriptase was performed for each sample.²⁸

The mRNAs of fatty acid synthase (FASN), acetyl-coenzyme A carboxylase-α (ACACA), fatty acid-binding protein 3 (FABP3), peroxisome proliferator-activated receptor gamma (PPARG or PPARγ), stearoyl-CoA desaturase (SCD), sterol regulatory element-binding factor 1 (SREBPF1), proliferating cell nuclear antigen (PCNA), cyclin A2 (CCNA2), cyclin D1 (CCND1), B-cell lymphoma 2 (BCL2), BCL2-associated X 4 (BAX4), BCL2/BAX4, Caspase 3 (CASP3) and Caspase 9 (CASP9) were quantified via quantitative reverse transcription-PCR using an iCycler and iQ-SYBR Green Supermix (Bio-Rad). Both glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) were selected as potential internal control genes with reference to the study of Busato et al.²⁹ The relative expressions of GAPDH and ACTB were compared, and no significant differences were found among the treatments; therefore, GAPDH was used as the housekeeping gene. Real-time PCR primers for the target genes are listed in Table 2. Real-time quantitative PCR was performed with an ABI QuantStudio5 instrument (Thermo Fisher Scientific, Fremont, NY). A 20-µL reaction mixture comprised 2 µL of cDNA, 10 µL of SYBR Premix Taq II (TaKaRa, San Jose, CA), 0.8 µL of forward primer (10 µM), 0.8 µL of reverse primer (10 µM), 0.4 µL of ROX Reference Dye II (TaKaRa) and 6.0 µL of nuclease-free water. The PCR cycling conditions were as follows: 1 cycle at 95 °C for 20 s for the original denaturation step, 40 cycles at 95 °C for 15 s, annealing at the annealing temperature of each target gene for 30 s and extension at 55 °C for 20 s.

Table 2. Real-time PCR primers for amplifying the target genes.

Gene^a	Primer sequence (5′–3′)	GenBank accession no.	Annealing temperature (°C)	Size (bp)
ACACA	F: CATCTTGTCCGAAACGTCGAT R: CCCTTCGAACATACACCTCCA	AJ132890	58.0	101
FASN	F: AGGACCTCGTGAAGGCTGTGA R: CCAAGGTCTGAAAGCGAGCTG	NM001012669	62.0	85
SCD	F: TCCTGTTGTTGTGCTTCATCC R: GGCATAACGGAATAAGGTGGC	AY241933	58.0	101
PPARG	F: AACTCCCTCATGGCCATTGAATG R: AGGTCAGCAGACTCTGGGTTC	NC_037349.1	60.0	323
SREBF1	F: CTGACGACCGTGAAAACAGA R: AGACGGCAGATTTATTCAACTT	NM001113302	60.0	334
FABP3	F: GAACTCGACTCCCAGCTTGAA R: AAGCCTACCACAATCATCGAAG	DN518905	60.0	102
CCNA2	F: ACCACAGCACGCACAACAGTC R: AGTGTCTCTGGTGGGTTGAGGAG	NC_037333.1	64.0	87
CCND1	F: GCCGAGGAGAACAAGCAGATCATC R: CATGGAGGGCGGGTTGGAAATG	NC_037356.1	63.0	96
PCNA	F: ACATCAGCTCAAGTGGCGTGAAC R: GCAGCGGTAAGTGTCGAAGCC	NC_037340.1	64.0	101
BCL2	F: TGTGGATGACCGAGTACCTGAA R: AGAGACAGCCAGGAGAAATCAAAC	NC_037351.1	60.0	127
BAX4	F: TTTTGCTTCAGGGTTTCATCCAGGA R: CAGCTGCGATCATCCTCTGCAG	NC_037345.1	62.0	174
CASP3	F: AGAACTGGACTGTGGCATTGAG R: GCACAAAGCGACTGGATGAAC	NC_037354.1	60.0	165
CASP9	F: CCAGGACACTCTGGCTTCAT R: CGGCTTTGATGGGTCATCCT	NC_037343.1	60.0	70
ACTB	F: ACTGTTAGCTGCGTTACACCCTT R: TGCTGTCACCTTCACCGTTCC	NM_173979.3	60.0	167
GAPDH	F: CCTGGAGAAACCTGCCAAGT R: AGCCGTATTCATTGTCATACCA	NC_037332.1	59.0	215

^aACACA: acetyl-coenzyme A carboxylase-α; ACTB: ß-actin; BAX4: BCL2 associated X; BCL2: BCL2 apoptosis regulator; CASP3: Caspase-3; CASP9: Caspase-9; CCNA2: cyclin A2; CCND1: cyclin D1; FASN: fatty acid synthase; FABP3: fatty acid-binding protein 3; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; PCNA: proliferating cell nuclear antigen; PPARG: peroxisome proliferator-activated receptor gamma; SCD: stearoyl-CoA desaturase; SREBF1: sterol regulatory element-binding factor 1.

Western blot analysis

The protein content was analysed using a Thermo Scientific Pierce BCA Protein Assay Kit (23225; Thermo Fisher Scientific) according to the manufacturer’s instructions; β-actin was used as the loading control. Equal quantities of protein (20 µg) were separated on a 12% SDS-PAGE, and the separated proteins were transferred onto nitrocellulose membranes (1704271; Bio-Rad). Membranes were blocked with 6% (wt/vol) BSA in tris-buffered saline plus Tween (TBST) for 2 h at 25 °C and were then incubated overnight at 4 °C with the following primary antibodies diluted in TBST: mouse anti-cyclin A1 (1:2000; cat. no. NB100-2660; Novusbio Biologicals, Centennial, CO), mouse anti-PCNA (1:2000; cat. no. 2586; Cell Signaling Technology, Danvers, MA), rabbit anti-Akt (1:2000; cat. no. 9272; Cell Signaling Technology), rabbit anti-phosphorylated-Akt_Ser473 (1:2000; cat. no. bs-0876R; Bios Antibodies, Boston, MA), rabbit anti-mTOR (1:2000; cat. no. bs-1992R; Bios Antibodies), rabbit anti-phosphorylated-mTOR_Ser2448 (1:2000; cat. no. bs-3495R; Bios Antibodies), rabbit anti-PPARγ (1:2000; cat. no. bs-4590R; Bios Antibodies), rabbit anti-phosphorylated-ACACA (1:2000; cat. no. bs-12954R; Bios Antibodies), rabbit anti-ACACA (1:2000; cat. no. bs-11912R; Bios Antibodies), rabbit anti-FASN (1:2000; cat. no. bs-60347R; Bios Antibodies), rabbit anti-SCD1 (1:2000; cat. no. bs-3787R; Bios Antibodies), rabbit anti-BCL2 (1:2000; cat. no. bs-20351R; BIOSS, Beijing, China), mouse anti-BAX (1:2000, cat. no. bs-0127M; BIOSS, Beijing, China), rabbit anti-Caspase 3 (1:2000, cat. no. bs-0081R; BIOSS, Beijing, China), rabbit anti-Caspase 9 (1:2000, cat. no. bs-0049R; BIOSS, Beijing, China) and rabbit anti-β-actin (1:10,000; cat. no. 4970; Cell Signaling Technology).

Membranes were washed five times with 1× TBST for 5 min to remove excess antibodies. Membranes were then incubated at 25 °C for 2 h with either of the following secondary antibodies diluted in TBST: goat anti-rabbit (1:5000; cat. no. E-AB-1003; Elabscience, Wuhan, China) or goat anti-mouse (1:5000; cat. no. RS0001; Immunoway, Plano, TX). A SuperSignal West Pico Chemiluminescence Substrate (Thermo Fisher Scientific) was used to visualize the western blots before being semi-quantified using ImageJ software version 1.4.3.67 (National Institutes of Health, Bethesda, MD).

Calculations and statistical analysis

Dietary net energy for lactation (NE_L) was estimated by multiplying the NE_L-3X density of the feed ingredient with the dietary content.³⁰ Energy-corrected milk (ECM) and fat-corrected milk (FCM) were calculated according to the NRC.¹⁹ The feed efficiency was calculated for each animal as milk/DMI and ECM/DMI. Data were analysed as a randomized complete-block design via the mixed procedure of SAS (PROC MIXED; SAS, 2002). Data for DMI, milk production, feed efficiency, milk fatty acid composition, nutrient digestibility and blood parameters were analysed using the following statistical model: $$Y_{\mathit{\text{iklm}}}=\mu +\beta V_k+B_i+D_j+C_{k(i}{}_{)}+L_l+D{L}_{\mathit{\text{jl}}}+E_{\mathit{\text{ijkl}}}$$ where Y_iklm represents the dependent variable; µ represents the overall mean; β represents the regression coefficient; V_k represents the covariate measurement; B_i represents the effect of block i; D_j represents the effect of day j; C_k(i) represents the effect of cow k within block i; L_l represents the effect of NANO-Se treatment l; DL_jl represents the interaction between day and NANO-Se treatment; and E_ijkl represents the residual error.

Data for ruminal fermentation and microbial enzymatic activity were analysed using the following statistical model for which there were repeated measurements over time (pH, VFA and enzymatic activity): $$Y_{\mathit{\text{iklm}}}=\mu +\beta V_k+B_i+D_j+C_{k(i)}+L_l+D{L}_{\mathit{\text{jl}}}+E_{\mathit{\text{ijkl}}}+T_m+L{T}_{\mathit{\text{ml}}}+S_{\mathit{\text{ijklm}}}$$ where Y_iklm represents the dependent variable; µ represents the overall mean; β represents the regression coefficient; V_k represents the covariate measurement; B_i represents the effect of block i; D_j represents the effect of day j; C_k(i) represents the effect of cow k within block i; L_l represents the effect of NANO-Se treatment l; DL_jl represents the interaction between day and NANO-Se treatment; E_ijkl represents the whole plot error; T_m represents the effect of time m; LT_ml represents the interaction between NANO-Se treatment and time; and S_ijklm represents the subplot error.

The spatial covariance structure SP was used for estimating the covariances, and the subject of the repeated measurements was defined as cow (block × day × treatment). Linear and quadratic orthogonal contrasts were performed using the CONTRAST statement of SAS with coefficients estimated based on the dose of added NANO-Se. Western blot data were analysed using the SigmaPlot version 12.5 (Systat Software, San Jose, CA) statistical analysis package. Statistical differences in the means of treatments were evaluated using the Student’s t-test. Data in graphs are presented as mean ± SEM. The effects of the factors were considered significant at p < 0.05 unless other trends were declared at p < 0.10.

Results

Feed intake, milk production, feed efficiency and milk fatty acid composition

Although the DMI was not affected by the increase in NANO-Se addition (Table 3), the production of milk tended to increase linearly (p = 0.064), whereas the FCM (4%, p = 0.049), ECM (p = 0.048), and milk fat production (p = 0.028) increased quadratically. The milk fat content increased quadratically (p = 0.039) and the milk protein content tended to increase quadratically (p = 0.071), whereas the milk lactose content did not change following NANO-Se addition. The feed efficiency, described as either milk yields/DMI or ECM yields/DMI, also quadratically increased (p < 0.05) following NANO-Se addition. As expected, the milk Se content increased linearly (p = 0.003) following NANO-Se addition.

Table 3. Effects of nanoselenium (NANO-Se) supplementation on the dry matter intake (DMI), lactation performance and feed efficiency in dairy cows.

Item	Treatments^a					p Value
	CON	LSe	MSe	HSe	SEM	Linear	Quadratic
DMI (kg/d)	22.4	22.5	22.7	22.4	0.20	0.88	0.70
Milk production (kg/d)
Actual	36.3	37.2	38.9	38.1	0.42	0.064	0.28
FCM^b	34.8	36.2	38.6	36.8	0.44	0.13	0.049
ECM^c	38.7	40.3	43.0	40.9	0.48	0.15	0.048
Fat	1.35	1.42	1.53	1.44	0.020	0.14	0.028
True protein	1.22	1.28	1.36	1.28	0.017	0.073	0.056
Lactose	2.02	2.05	2.12	2.14	0.024	0.049	0.87
Milk composition (g/kg)
Fat	37.2	38.1	39.4	37.9	0.31	0.22	0.039
True protein	33.6	34.3	34.8	33.9	0.22	0.51	0.071
Lactose	55.6	55.0	54.5	56.1	0.18	0.58	0.19
Feed efficiency (kg/kg)^d
Milk yield/DMI	1.59	1.66	1.71	1.69	0.006	0.063	0.005
ECM yield/DMI	1.72	1.79	1.89	1.82	0.009	0.061	0.004
Milk Se (µg/kg)	20.4	30.3	39.7	47.9	0.95	0.003	0.21

^aControl (CON) and low Se (LSe), medium Se (MSe) and high Se (HSe) treatment groups with 0, 0.1, 0.3 and 0.5 mg of Se from NANO-Se per kg dietary dry matter, respectively.

^bFCM was calculated according to the NRC,¹⁹ where 4.0% FCM = 0.4 × milk (kg/d) + 15 × fat (kg/d).

^cECM was calculated according to the NRC,¹⁹ where ECM = [0.327 × milk (kg/d)] + [12.95 × fat (kg/d)] + [7.65 × protein (kg/d)].

^dEstimated as milk yields (milk and ECM yields) divided by DMI for each dairy cow.

Although the proportion of C16:0 fatty acids was quadratically increased (p = 0.009), the proportion of saturated fatty acids (SFAs) decreased linearly (p = 0.021) due to the quadratically decreased levels of C6:0 and C12:0, and the linearly decreased levels of C8:0 and C10:0 with increasing NANO-Se addition (Table 4). For monounsaturated fatty acids (MUFA), the linear (p = 0.036) increase in the C18:1 fatty acid content caused by the linear (p = 0.024) increase in the C18:1 cis-9 fatty acid content resulted in a linear (p = 0.033) increase in the MUFA content, regardless of the linear (p = 0.016) increase in the C12:1 cis-9 fatty acid content. Furthermore, the proportion of polyunsaturated fatty acids (PUFAs) increased quadratically (p = 0.024) because of the quadratically (p = 0.012) increased content of nonconjugated C18:2 fatty acids and the linearly (p = 0.031) increased content of C20:0:3n-6 fatty acids with increasing NANO-Se addition. Thus, the proportion of short-chain fatty acids (SCFAs) decreased quadratically (p = 0.042), whereas the proportion of mixed sourced fatty acids (MSFAs) increased quadratically (p = 0.007) following NANO-Se addition. The proportion of preformed fatty acids (PFA) increased linearly (p = 0.008), whereas odd- and branched-chained fatty acids were not influenced by NANO-Se addition. For the desaturation ratios, only the ratio of rumenic acid (RA; cis-9, trans-11 C18:2) to the sum of RA and vaccenic acid (VA; trans-11 C18:1) was increased quadratically (p = 0.044) with increasing NANO-Se addition.

Table 4. Effects of nanoselenium (NANO-Se) supplementation on milk fatty acid composition of milk fat in lactating dairy cows (g/100 g of fatty acids).

Item	Treatments^a					p Value
	CON	LSe	MSe	HSe	SEM	Linear	Quadratic
SFA^b	70.91	69.04	67.91	67.09	0.312	0.021	0.34
C4:0	3.09	3.01	2.88	2.99	0.027	0.66	0.80
C5:0	0.02	0.02	0.02	0.02	0.001	0.14	0.26
C6:0	2.33	2.18	2.02	2.09	0.016	0.22	0.016
C7:0	0.03	0.03	0.03	0.03	0.001	0.24	0.15
C8:0	3.21	2.63	2.37	2.34	0.048	0.008	0.31
C9:0	0.05	0.05	0.06	0.06	0.001	0.14	0.46
C10:0	9.25	7.93	6.86	6.88	0.136	0.023	0.16
C11:0	0.06	0.06	0.07	0.08	0.002	0.21	0.56
C12:0	4.74	3.83	3.56	3.65	0.079	0.15	0.011
C14:0 iso	0.11	0.11	0.12	0.12	0.002	0.078	0.89
C14:0	10.91	9.92	9.35	10.17	0.118	0.13	0.45
C15:0 iso	0.24	0.24	0.24	0.24	0.003	0.57	0.90
C15:0	0.88	0.96	0.97	0.96	0.021	0.18	0.63
C16:0 iso	0.30	0.29	0.29	0.27	0.004	0.16	0.94
C16:0	23.73	24.93	26.35	24.99	0.203	0.12	0.009
C17:0 iso	0.42	0.43	0.44	0.44	0.009	0.66	0.65
C17:0	0.95	0.97	0.99	1.01	0.015	0.32	0.43
C18:0 iso	0.04	0.04	0.04	0.04	0.002	0.40	0.64
C18:0	10.20	11.04	11.02	10.32	0.076	0.59	0.11
C20:0	0.05	0.05	0.05	0.05	0.004	0.32	0.21
C22:0	0.11	0.11	0.11	0.12	0.003	0.17	0.30
C23:0	0.06	0.06	0.06	0.07	0.002	0.16	0.35
C24:0	0.11	0.11	0.10	0.11	0.002	0.68	0.26
MUFA^c	23.35	24.51	25.15	26.34	0.251	0.033	0.95
C12:1 cis-9	0.08	0.06	0.05	0.05	0.002	0.016	0.33
C14:1 cis-9	0.16	0.17	0.18	0.17	0.003	0.42	0.008
C16:1 trans-9 + trans-7	0.44	0.42	0.39	0.42	0.011	0.55	0.71
C16:1 cis-9	0.74	0.78	0.76	0.82	0.038	0.40	0.75
C17:1 cis-5 + cis-7 + cis-9	0.21	0.21	0.20	0.20	0.005	0.54	0.58
Σ C18:1	21.73	22.5	23.56	24.67	0.227	0.036	0.97
C18:1 trans-11	1.96	1.68	1.49	1.52	0.024	0.35	0.41
C18:1 trans-6 + 7 + 9 + 10 + 12	1.98	1.96	1.90	1.93	0.014	0.17	0.32
C18:1 cis-9	16.32	17.73	18.72	19.65	0.206	0.024	0.45
C18:1 cis-11 + cis-12	0.71	0.73	0.69	0.74	0.036	0.92	0.85
C18:1 cis-14 + trans-16	0.42	0.42	0.43	0.43	0.009	0.33	0.71
C20:1	0.14	0.16	0.16	0.17	0.003	0.16	0.83
C22:1	0.08	0.08	0.08	0.09	0.002	0.34	0.30
C24:1	0.09	0.09	0.09	0.10	0.001	0.52	0.42
PUFA^d	5.72	6.46	6.94	6.56	0.072	0.22	0.024
Conjugated C18:2	0.90	0.85	0.76	0.74	0.017	0.15	0.62
C18:2 cis-9, trans-11	0.80	0.77	0.68	0.68	0.016	0.12	0.65
C18:2 trans-7, cis-9	0.07	0.05	0.04	0.03	0.002	0.013	0.18
C18:2 cis-11, cis-13	0.03	0.04	0.04	0.04	0.002	0.18	0.33
Nonconjugated C18:2	3.53	4.27	4.78	4.38	0.061	0.21	0.012
C18:2 cis-9, cis-12	1.26	1.58	1.73	1.60	0.025	0.12	0.006
C18:2 trans-9, trans-12	0.85	1.07	1.25	1.08	0.020	0.15	0.015
C18:2 trans-10, cis-12	0.73	0.92	1.06	0.97	0.017	0.17	0.007
Other cis, trans + trans, and cis	0.69	0.70	0.73	0.73	0.007	0.32	0.69
Other PUFA	1.29	1.33	1.41	1.44	0.021	0.005	0.94
C18:3n-6	0.44	0.45	0.48	0.47	0.009	0.10	0.55
C18:3n-3	0.26	0.28	0.26	0.28	0.010	0.79	0.91
C20:2n-6	0.04	0.03	0.03	0.02	0.002	0.24	0.95
C20:3n-6	0.08	0.09	0.11	0.11	0.004	0.031	0.68
C20:4n-6	0.21	0.22	0.26	0.27	0.005	0.12	0.78
C20:5n-3	0.13	0.12	0.13	0.14	0.004	0.63	0.16
C22:2n-6	0.05	0.06	0.06	0.06	0.002	0.18	0.27
C22:5n-3	0.07	0.07	0.08	0.08	0.002	0.17	0.87
Summation
SCFA^e	33.80	29.73	27.25	28.35	0.349	0.18	0.042
MSFA^f	24.88	26.13	27.53	26.24	0.210	0.12	0.007
PFA^g	38.24	40.97	42.11	42.22	0.289	0.008	0.16
OBCFA^h	3.18	3.27	3.24	3.36	0.033	0.10	0.87
Desaturation ratios
RA/(RA + VA)^i	0.29	0.32	0.31	0.31	0.004	0.15	0.044
C14:1/(C14:0 + C14:1)	0.02	0.02	0.02	0.02	0.004	0.59	0.21
C16:1/(C16:0 + C16:1)	0.04	0.04	0.04	0.05	0.002	0.69	0.11
C18:1/(C18:0 + C18:1)	0.67	0.67	0.68	0.70	0.003	0.21	0.43

^aControl (CON) and low Se (LSe), medium Se (MSe) and high Se (HSe) treatment groups with 0, 0.1, 0.3 and 0.5 mg of Se from NANO-Se per kg dietary dry matter, respectively.

^bSFA: saturated fatty acids.

^cMUFAs: monounsaturated fatty acids.

^dPUFAs: polyunsaturated fatty acids.

^eDe novo FA: de novo fatty acids: sum of C4:0; C6:0; C8:0; C10:0; C12:0; C14:0; C12:1; and C14:1.

^fMSFAs: mixed sourced fatty acids: sum of C16:0; trans-9 + trans-7 C16:1; and cis-9 C16:1.

^gPFA: preformed fatty acids: sum of C18:0; C20:0; C22:0; C24:0; C18:1; C20:1; C22:1; C24:1; C18:2; C18:3; C20:2; C20:3; C20:4; C20:5; C22:2; and C22:5.

^hOBCFA: odd- and branched-chained fatty acids: sum of C5:0; C7:0; C9:0; C11:0; iso C14:0; C15:0; iso C15:0; iso C16:0; C17:0; iso C17:0; c23:0; and cis-5 + cis-7 + cis-9 C17:1.

ⁱRA: rumenic acid, cis-9, trans-11 C18:2; VA: vaccenic acid, trans-11 C18:1.

Digestibility, ruminal fermentation and microbial enzymatic activities

The digestibility of dietary DM, OM, crude protein (CP), NDF and ADF was increased quadratically (p < 0.05) with NANO-Se addition, although the digestibility of ether extract was unaffected (Table 5). The ruminal pH was quadratically decreased (p = 0.006), whereas the ruminal total VFA concentration increased linearly (p = 0.033) following NANO-Se addition. The molar percentage of acetate was unaffected by NANO-Se addition, whereas that of propionate was increased quadratically (p = 0.004) and that of butyrate was decreased quadratically (p = 0.047) following NANO-Se addition. Moreover, the acetate-to-propionate ratio was decreased quadratically (p = 0.034) with increasing NANO-Se addition. Conversely, the molar percentages of valerate, isobutyrate, and isovalerate were unaffected by NANO-Se addition. The ruminal ammonia N concentration decreased quadratically (p = 0.021) following NANO-Se addition. Although the enzymatic activity of protease was unaffected by NANO-Se addition, the activity of CMCase, xylanase, cellobiase, and pectinase increased linearly (p < 0.05) following NANO-Se addition. The activity of α-amylase increased linearly (p = 0.005) with an increase in NANO-Se dosage.

Table 5. Effects of nanoselenium (NANO-Se) supplementation on nutrient digestibility and ruminal fermentation in lactating dairy cows.

Item	Treatments^a					p Value
	CON	LSe	MSe	Hse	SEM	Linear	Quadratic
Nutrient digestibility (%)
Dry matter	70.9	74.5	76.1	75.5	0.24	0.10	0.020
Organic matter	73.1	76.5	77.8	76.9	0.22	0.093	0.016
Crude protein	67.1	68.3	71.8	69.0	0.43	0.21	0.012
Ether extract	86.8	87.4	90.3	88.6	0.53	0.35	0.28
Neutral detergent fiber	58.6	62.1	65.0	64.1	0.39	0.11	0.032
Acid detergent fiber	48.1	53.9	56.3	55.2	0.54	0.15	0.041
Ruminal fermentation
pH	6.68	6.52	6.19	6.55	0.030	0.12	0.006
Total VFA (mM)	136	139	143	141	0.9	0.033	0.17
Mol/100 mol
Acetate	62.3	61.9	61.4	61.4	0.33	0.26	0.75
Propionate	21.8	22.9	25.5	23.4	0.29	0.11	0.004
Butyrate	12.0	11.6	10.0	10.8	0.17	0.23	0.047
Valerate	1.61	1.52	1.43	1.61	0.029	0.71	0.19
Isobutyrate	0.83	0.76	0.66	0.77	0.016	0.43	0.24
Isovalerate	1.36	1.29	1.03	1.26	0.029	0.19	0.15
Acetate:propionate	2.88	2.74	2.44	2.66	0.045	0.12	0.034
Ammonia N (mg/dL)	12.6	11.6	10.1	11.8	0.17	0.24	0.021
Enzyme activity^b
Carboxymethyl cellulase	0.194	0.209	0.264	0.265	0.0049	0.032	0.34
Cellobiase	0.177	0.194	0.231	0.238	0.0036	0.019	0.29
Xylanase	0.716	0.749	0.858	0.861	0.0094	0.024	0.22
Pectinase	0.598	0.631	0.689	0.703	0.0105	0.013	0.61
α-Amylase	0.643	0.678	0.688	0.672	0.0047	0.18	0.005
Protease	0.804	0.729	0.841	0.678	0.0122	0.13	0.26

^aControl (CON) and low Se (LSe), medium Se (MSe) and high Se (HSe) treatment groups with 0, 0.1, 0.3 and 0.5 mg of Se from NANO-Se per kg dietary dry matter, respectively.

^bUnits of enzyme activity are as follows: carboxymethyl cellulase (µmol glucose/min/mL), cellobiase (µmol glucose/min/mL), xylanase (µmol xylose/min/mL), pectinase (µmol D-galacturonic acid/min/mL), α-amylase (µmol maltose/min/mL), β-amylase (µmol maltose/min/mL) and protease (µg hydrolysed protein/min/mL).

Blood metabolites

The blood concentrations of glucose, albumin, and total protein were increased quadratically (p < 0.05) following NANO-Se addition (Table 6). Furthermore, the concentration of estradiol, prolactin, IGF-1 and Se increased linearly (p < 0.05) with increasing NANO-Se addition. Conversely, the blood urea nitrogen (BUN) content decreased quadratically (p = 0.044) following NANO-Se addition.

Table 6. Effects of nanoselenium (NANO-Se) addition on blood metabolites in lactating dairy cows.

Item	Treatments^a					p Value
	CON	LSe	MSe	HSe	SEM	Linear	Quadratic
Glucose (mmol/L)	6.75	7.02	7.75	7.33	0.069	0.11	0.026
Total protein (g/L)	74.1	79.4	80.9	78.2	0.67	0.16	0.014
Albumin (g/L)	33.8	37.3	38.7	35.8	0.43	0.37	0.032
BUN (mmol/L)	6.85	6.67	6.59	6.89	0.058	0.90	0.044
Triglycerides (mmol/L)	2.26	2.16	2.19	2.18	0.033	0.52	0.49
Estradiol (pg/mL)	54.8	57.8	68.2	67.1	0.63	0.016	0.23
Prolactin (mIU/L)	580	626	640	791	9.3	0.021	0.36
IGF-1 (ng/mL)	206	240	251	256	2.2	0.018	0.41
Se (µg/L)	122	132	142	149	1.2	0.009	0.34

BUN: blood urea nitrogen; IGF-1: insulin-like growth factor 1

^aControl (CON) and low Se (LSe), medium Se (MSe) and high Se (HSe) treatment groups with 0, 0.1, 0.3 and 0.5 mg of Se from NANO-Se per kg dietary dry matter, respectively.

Expressions of genes and proteins involved in fatty acid synthesis

Regarding fatty acid synthesis, 0.3 mg/kg of Se from NANO-Se significantly increased the mRNA levels of PPARG (p < 0.01), SREBPF1 (p < 0.05), ACACA (p < 0.01), FASN (p < 0.01), SCD (p < 0.01) and FABP3 (p < 0.01) in comparison with those of the control (Fig. 1A). The protein levels of PPARγ, SREBP1, p-ACACA/ACACA, FASN (p < 0.01) and SCD (p < 0.01) were uniformly increased upon addition of 0.3 mg/kg of Se from NANO-Se compared with those in the control (Fig. 1B,C).

Figure 1. Effects of dietary nanoselenium (NANO-Se) addition on the expressions of genes and proteins related to fatty acid synthesis in the bovine mammary gland. (A) mRNA levels of peroxisome proliferator-activated receptor gamma (PPARG or PPARγ), sterol regulatory element-binding factor 1 (SREBF1), acetyl-coenzyme a carboxylase-α (ACACA), fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD) and fatty acid-binding protein 3 (FABP3) in bovine mammary glands treated with NANO-Se (0 and 0.3 mg/kg of Se). GAPDH was used as the reference gene. The relative mRNA expression level of each target gene was standardized to that in the control group. (B) Western blot analysis of PPARγ, sterol regulatory element-binding protein 1 (SREBP1), ACACA, FASN, SCD1 and FABP3 in bovine mammary gland tissues; β-actin was used as the loading control. (C) Mean ± SEM of immunopositive bands of PPARγ, SREBP1, ACACA, FASN, SCD1 and FABP3. The relative protein expression level of each target protein was standardized to that in the control group. *p < 0.05 and **p < 0.01 versus the control group.

Expressions of genes and proteins involved in cell proliferation

The CCNA2 and CCND1 genes encode CCNA2 and D1, respectively. Supplementation of 0.3 mg/kg of Se from NANO-Se increased the mRNA levels of PCNA (p < 0.05), CCNA2 (p < 0.01) CCND1 (p < 0.05), BCL2 (p < 0.05) and BCL2/BAX4 (p < 0.01) and decreased those of BAX4 (p < 0.01), CASP3 (p < 0.01) and CASP9 (p < 0.01) (Fig. 2A) compared with those in the control. The protein levels of PCNA (p < 0.01), CCNA1 (p < 0.01), BCL2 (p < 0.05) and BCL2/BAX (p < 0.01) were increased, whereas those of BAX (p < 0.01), Caspase-3 (p < 0.01) and Caspase-9 (p < 0.01) were decreased upon addition of 0.3 mg/kg of Se from NANO-Se compared with those in the control (Fig. 2B,C). Furthermore, the probable involvement of the Akt/mTOR signaling pathway was assessed (Fig. 3). The protein expression ratios of p-Akt:Akt (p < 0.01) and p-mTOR:mTOR (p < 0.05) were also significantly increased following NANO-Se addition (Fig. 3A,B).

Figure 2. Effects of dietary nanoselenium (NANO-Se) addition on proliferation-related mRNA and protein expressions in the bovine mammary gland. (A) mRNA levels of proliferating cell nuclear antigen (PCNA), cyclin A2 (CCNA2), cyclin D1 (CCND1), B-cell lymphoma 2 (BCL2), BCL2-associated X 4 (BAX4), BCL2/BAX4, Caspase 3 (CASP3) and Caspase 9 (CASP9) in bovine mammary glands treated with NANO-Se (0 and 0.3 mg/kg of Se). GAPDH was used as the reference gene. The relative mRNA expression level of each target gene was standardized to that in the control group. (B) Western blot analysis of PCNA, cyclin A1 (CCNA1), BCL2, BAX, BCL2/BAX, Caspase 3 and Caspase 9 in bovine mammary gland tissues; β-actin was used as the loading control. (C) Mean ± SEM of the immunopositive bands of PCNA, CCNA1, BCL2, BAX, BCL2/BAX, Caspase 3 and Caspase 9. The relative protein expression level of each target protein was standardized to that in the control group. *p < 0.05 and **p < 0.01 versus the control group.

Figure 3. Effects of dietary nanoselenium (NANO-Se) addition on the Akt-mTOR signaling pathway in the bovine mammary gland. (A) Western blot analysis of Akt, p-Akt, mTOR and p-mTOR in bovine mammary glands treated with NANO-Se (0 and 0.3 mg/kg of Se from NANO-Se); β-actin was used as the loading control. (B) Mean ± SEM of the immunopositive bands of p-Akt/Akt and p-mTOR/mTOR. The relative protein expression level of each target protein was standardized to that in the control group. *p < 0.05 and **p < 0.01 versus the control group.

Discussion

Feed intake, milk yields and feed efficiency

The linear increase in the DMI of dairy cows agrees with the increased dietary NDF and ADF digestibility following the NANO-Se addition in this study and a previous positive correlation between dietary DMI and NDF digestibility in dairy cows.³¹ Similarly, Zhang et al. demonstrated that the increased DMI was due to the increased NDF digestibility with coated sodium selenite addition.¹¹ The increase in the production of FCM, ECM and milk fat was attributed to the positive effects of NANO-Se supplementation on DMI, total VFA concentration, digestibility and the proliferation of mammary gland cells. Moreover, the increase in feed efficiency indicated that dietary NANO-Se addition enhanced the utilization of nutrients in cows. Acetate and butyrate produced by rumen fermentation are precursor substances of milk fatty acid synthesis³² and approximately 60% of glucose used for the synthesis of milk lactose is derived from hepatic gluconeogenesis via propionate.³³ Therefore, the increased ruminal acetate and propionate contents resulted in a higher production of milk fat and FCM with NANO-Se supplementation. Similarly, previous studies demonstrated that yields of milk and milk fat were increased following 0.3 mg/kg of Se addition from Se-yeast^9,10 or from coated sodium selenite¹¹ in comparison with those in control diets. The linearly increased concentration of Se in dairy cow milk from 20.4 µg/kg (control) to 47.9 µg/kg (0.5 mg of Se from NANO-Se per kg dietary DM) revealed a dose effect of the NANO-Se addition and confirmed the findings observed by previous studies where 2–40 mg/d of Se-yeast was provided to cows.^34–36

Milk fat composition

The reduction of SFA proportions and the elevation of MUFA and PUFA proportions in milk fat following NANO-Se addition implied that supplementation with NANO-Se stimulated the dehydrogenation of SFA in the mammary gland and then improved the synthesis of MUFA and PUFA. These findings were confirmed by the increased mRNA expression of SCD and the increased ratio of RA to the sum of RA and VA with increasing NANO-Se addition. The proportions of SCFA were decreased and those of MSFA and PFA, and in particular C16:0, cis-C18:1, nonconjugated C18:2 and C20:3n-6, were increased following NANO-Se addition. These findings agree with the result of Pulido et al. who demonstrated a reduction in the content of several SCFAs and an increase in that of the C18:1 fatty acids.³⁷ De novo synthesis of SCFAs depends on the plasma concentration of acetate and β-hydroxybutyric acid and is downregulated by increasing the plasma concentration of long-chain fatty acids through the activity of acetyl CoA carboxylase.^38,39 Although the ruminal acetate concentration increased, the proportions of SCFAs in milk fat decreased quadratically, whereas the proportions of MSFA and PFA increased following NANO-Se addition. Nevertheless, the unchanged DMI and fat digestibility cannot support the increase in the proportions of long-chain fatty acids,³⁷ and thus other mechanisms could be involved. Vázquez-Añón et al. suggested oxidative protection of cis-9 C18:1 in feed to explain the elevation in the proportion of this FA in milk in response to Se supplementation.⁴⁰

Nutrient digestion and ruminal fermentation

The increased response in nutrient digestibility following NANO-Se addition was caused by enhanced ruminal fermentation and microbial enzymatic activity, supporting the improved FCM and ECM production. Furthermore, the quadratic influence of NANO-Se on dietary DM, OM, CP, NDF and ADF digestibility suggested that greater doses of NANO-Se would decrease dietary DM, OM, CP, NDF and ADF digestibility and support the quadratic production of FCM and ECM following the increased NANO-Se doses. Zhang et al. also found that the positive effect of a high concentration of Se on the antioxidant function was gradually diminished in healthy BMECs.¹⁶ Based on these results, a moderate dose of NANO-Se (0.3 mg/kg of Se) is beneficial for nutrient digestion.

The quadratical decreased ruminal pH with increasing NANO-Se addition as in previous observations was due to the the increased total VFA concentration.¹¹ The increased total VFA concentration and acetate concentrations (84.7, 86.0, 87.8 and 86.6 mM for 0, 0, 0.1, 0.3 and 0.5 mg of Se from NANO-Se per kg dietary DM, respectively) were in agreement with the increased dietary DM digestibility and were attributed to ruminal enzymatic activities (CMCase, cellobiase, xylanase and pectinase) following NANO-Se addition. Furthermore, the quadratically decreased acetate-to-propionate ratios were due to the unaltered acetate molar percentage and linearly increased propionate molar percentage. This implied that the ruminal fermentation pattern tended toward propionate formation under increased NANO-Se addition conditions.

In cows, dietary fiber is degraded to acetate by the ruminal bacteria, protozoa and fungi that secrete cellulolytic enzymes.⁴¹ Feed lignocellulosic tissues can be degraded by ruminal fungi, and approximately 30% of fiber digestion and 10% of VFA production could be due to ruminal protozoa.⁴² Therefore, the linear increase in ruminal CMCase, cellobiase and xylanase activities with an increasing NANO-Se dosage was a consequence of the increased populations of total bacteria, including Ruminococcus albus and Ruminococcus flavefaciens and total anaerobic fungi.¹¹ Moreover, this result supported the enhanced total ruminal VFA and increased dietary NDF and ADF digestibility. Dietary Se can be used by ruminal microbes for protein and cell wall synthesizes⁴³ and subsequently the increased antioxidant status of the ruminal microbes is beneficial for microbial growth.⁴⁴ Furthermore, populations of total ruminal bacteria and protozoa have been shown to increase by supplementation with additional Se in sheep diets⁴⁴ and in dairy cow diets.¹¹ The quadratic increase in α-amylase activity and a linear increase in pectinase activity were consistent with the increase in the R. amylophilus population,^11,45 indicating that NANO-Se addition promoted ruminal starch degradation and supporting the increase in propionate molar percentage. The unaltered ruminal protease activity was mainly associated with the unchanged Prevotella ruminicola population.¹¹ Furthermore, this finding confirmed that microbial protein synthesis was promoted, as demonstrated by the linear decline in the ammonia N concentration with increased NANO-Se supplementation because ruminal microbes utilize carbon skeletons and ammonia N to synthesize microbial proteins.⁴⁶ The results were consistent with the addition of Se at 0.3 mg/kg from NANO-Se in sheep diets¹⁵ and from Se-yeast in dairy cow diets.⁹

Blood metabolites

Levels of blood glucose quadratically increased following NANO-Se addition, which agrees with the results of previous studies with Se-yeast⁹ and coated sodium selenite¹¹ addition in dairy cows, and may be ascribed to an increase in the ruminal propionate output,⁴⁷ since propionate produced by ruminal fermentation is transported to the liver and subsequently converted to glucose.⁴⁸ The total protein, albumin and BUN contents are indicators of the efficiency of protein utilization.⁴⁹ We observed increased albumin and total protein levels and decreased BUN content following NANO-Se supplementation. This may suggest that the feed either promoted the efficiency of protein utilization for milk protein secretion or lowered the mobilization of body proteins.⁵⁰ Estradiol, prolactin and IGF-1 are recognized as being vital for mammary duct development,⁵¹ and ovary-derived estradiol, prolactin and IGF-1 stimulate epithelial cell proliferation.⁵² In addition, IGF-1 activates the PI3K/Akt signaling pathway through its receptor and promotes the proliferation of epithelial cells.⁵³ Therefore, the NANO-Se-induced elevation of serum estradiol, prolactin and IGF-1 levels seen in this study supports the notion that NANO-Se stimulates mammary gland development. The linearly increased level of blood Se with increasing NANO-Se addition indicated that NANO-Se was effectively absorbed. Moreover, Han et al. demonstrated that the blood Se content and GSH-Px activity were increased by NANO-Se addition in comparison with that of sodium selenite addition.¹⁸

Expressions of genes and proteins implicated in fatty acid synthesis

In the mammary gland, both PPARG and SREBPF1 regulate the expressions of ACACA, FASN, SCD and FABP3 mRNA.^54,55 Moreover, both FASN and ACACA are involved in the synthesis of milk fatty acids from acetic acid and β-hydroxybutyric acid⁵⁴ and are positively correlated with the secretion of C_4–16 fatty acids.⁵⁶ SCD catalyses the synthesis of MUFA from SFA.^57,58 Furthermore, FABP3 is related to long-chain fatty acid absorption and transport in BMECs.⁵⁸ The increased levels of mRNA and proteins of FASN, ACACA, PPARG, SCD and SREBPF1 following NANO-Se supplementation indicated that the expressions of genes and proteins involved in the synthesis of SCFAs and medium-chain fatty acids were upregulated, supporting the elevation in the milk fat yield and milk MUFA. The increased mRNA expression of FABP3 indicated that NANO-Se addition stimulated the genes involved in long-chain fatty acid synthesis, absorption and transport in the bovine mammary gland.

Expressions of genes and proteins implicated in cell proliferation and apoptosis

Stimulating cell proliferation and suppressing cell apoptosis in the mammary gland should be the critical control point that promotes lactation persistence in dairy cows.⁵⁹ Cyclin D modulates the transition from the G1 phase to the S phase of the cell cycle, while cyclin A is considered essential for initiating and completing DNA replication in the S phase.⁶⁰ In addition, PCNA is an indispensable component of both DNA replication and repair.⁶¹ Moreover, previous studies demonstrated the involvement of cyclin D3 and PCNA in modulating mammary epithelial cell proliferation.⁶² We demonstrated that NANO-Se addition increased the expressions of mRNA cyclin (CCNA2 and CCND1) and PCNA mRNA and those of CCNA1 and PCNA proteins, indicating that NANO-Se stimulates the proliferation of mammary epithelial cells. Apoptosis is executed in cells via a highly complex signaling cascade by two paths, the mitochondrial and death receptor pathways, and is induced by the BCL2 family proteins. Furthermore, the BCL2 family proteins participate in the modulation of apoptotic cell death, including antiapoptotic (BCL2, etc.) and proapoptotic (BAX, etc.) members.⁶³ Since BCL2 prevents apoptosis by inhibiting the activity of BAX, a high BCL2/BAX ratio is an indication of suppressed apoptosis. Therefore, the ratio of the levels of BCL2/BAX proteins could indicate the status of cellular apoptosis. Both the mitochondrial and death receptor pathways converge onto the common pathway of executioner caspases (Caspase-3 and Caspase-9),⁶⁴ which play a crucial part in the execution phase of cell apoptosis, and reducing caspase expression suppresses the initiation of apoptosis. Herein, the increased expressions of BCL2 mRNA and protein and the BCL2/BAX ratio and the decreased expressions of BAX mRNA and protein and Caspase-3 and Caspase-9 suggested that the addition of NANO-Se promoted the expressions of apoptotic markers. Therefore, NANO-Se likely modulated proliferation by stimulating the expressions of proliferative markers and inhibiting the expressions of apoptotic markers. Similarly, Zhang et al. demonstrated that the addition of 50–200 nM Se significantly increased the cell viability and relative growth rate of BMECs, with 50 nM Se being the optimum dose.¹⁶

Other studies have implicated the Akt signaling pathway in the modulation of the proliferation and apoptosis of various cells, such as breast cancer cells⁶⁵ and BMECs.⁶⁶ Furthermore, the mTOR signaling pathway is implicated in regulating the proliferation of various cells.⁶⁷ In this study, the addition of NANO-Se stimulated Akt and mTOR phosphorylation. These findings suggest that activation of the Akt-mTOR signaling pathway may stimulate the expressions of proliferative markers and consequently increase milk production and milk fat synthesis with NANO-Se addition.

Conclusion

In conclusion, we demonstrated that supplementation of NANO-Se in dairy cow diets improved milk yields and the feed efficiency by stimulating total tract nutrient digestion, ruminal fermentation and mammary gland fatty acid synthesis. Moreover, the addition of NANO-Se activated the Akt/mTOR pathway and promoted the expressions of proliferative markers. It is advisable to study the effect of nano-Se compared to common mineral sources of selenium.

Authors contributions

Yapeng Liu: Formal analysis, writing (original draft) and visualization. Jing Zhang: Visualization, writing (original draft) and project administration. Lijun Bu: Data curation. Caixia Pei: Methodology and validation. Wenjie Huo: Methodology. Chengqiang Xia: Software and validation. Qiang Liu: Conceptualization, funding acquisition, software, supervision and editing.

Disclosure statement

The authors declare no conflicts of interest.

Additional information

Funding

This work was funded by the Science and Technology Innovation Fund Project of Shanxi Agricultural University (Grant no. 2018YJ36) and the Key Laboratory of Molecular Animal Nutrition of the Ministry of Education at Zhejiang University.