Effects of dietary supplementation of grape seed extract in comparison with excessive level of vitamin E on growth performance and antioxidant function of broilers

Abstract

The present study was carried out to evaluate the effects of dietary vitamin E (VE) or grape seed extract (GSE) on the growth performance and antioxidant function of broilers. Two hundred sixteen broiler chicks were randomly assigned to 3 diets: diet supplemented with oxidized rice bran oil (CN group), CN group with 25 mg/kg VE or 100 mg/kg GSE. Dietary VE or GSE improved the growth performance, reverted the disturbed levels of liver antioxidant enzymes, and reduced liver damage of broilers fed oxidized rice bran oil. The mRNA data showed that supplementation of VE or GSE enhanced the antioxidant capacity of the broiler liver through activation of the Keap1-Nrf2/ARE signaling pathway. The results suggested that VE and GSE can increase weight gain, improve the oxidative status, and alleviate liver injury in broiler chicken fed oxidized rice bran oil.

Keywords:

• Grape seed extract
• broiler
• vitamin E
• weight gain
• oxidation

Introduction

Abundant quantities of rice bran are readily available in various regions worldwide, particularly in China. Several studies have shown that the addition of crude rice bran oil to broiler diets could produce beneficial effects similar to those of finished oils, but at a lower cost.^1,2 However, lipoxygenases in rice bran oil can lead to the oxidation and breakdown of unsaturated fatty acids, potentially compromising flavor.³ Moreover, forming free radicals poses health risks for poultry when consuming oxidized oils.⁴ Research has indicated that the consumption of oxidized oils reduces the activity of antioxidant enzymes in tissues and blood, increasing the malondialdehyde content,⁵ thereby reducing overall antioxidant capacity. Consequently, there has been significant interest in incorporating natural or synthetic antioxidant supplements into poultry diets to mitigate the detrimental effects caused by free radicals.⁶

Several antioxidants, such as synthetic vitamin E, ethoxyquinoline, and butylated hydroxytoluene, have been used in recent years due to their beneficial effects against oxidative stress.^7,8 Natural antioxidants are widely recognized for their safety compared to synthetic antioxidants, resulting in an increasing demand for natural products. The GSE (grape seed extract) is a mixture of polyphenols extracted from grape seeds.⁹ GSE contains monomeric phenols and proanthocyanidins with varying degrees of polymerization. The monomeric phenols mainly include gallic acid, catechin, epicatechin, and gallate esters.¹⁰ The polyphenolic substances extracted from grape seeds possess a powerful antioxidant capacity and serve as natural antioxidants.¹¹ Fang et al. (2021) reported that GSE could improve serum antioxidant capacity of pigles.¹²

Vitamin E (VE) requirement of broiler chicks, recommended by National Research Council (NRC, 1994), is 10 mg/kg of diet.¹³ But Guo et al.¹⁴ demonstrated that dietary VE of 20 to 30 mg/kg could sustain relatively constant hepatic α-tocopherol level at round about 2 to 2.5 μg/kg.¹⁴ Leshchinsky and Klasing (2001) reported that VE supplementation of broiler chickens in moderate amounts (25 to 50 mg/kg) had the greatest effect on immunomodulation, whereas supplementation with large amounts of VE was less effective.¹⁵ Our recent study observed that dietary supplementation with 100 mg/kg GSE could enhance growth performance, antioxidant status, and liver function of Lohmann chicks exposed to diquat-induced oxidative stress.¹⁶ Therefore, we hypothesized that the antioxidant effect of 100 mg/kg grape seed extract on broilers would be better than adding an additional 25 mg/kg vitamin E. The objective of this study was to evaluate supplementation of excess vitamin E or grape seed extract in the diet to improve broiler growth retardation and oxidative damage caused by excessive intake of oxidized oils, which could help us to use grape seed extract as feed additives correctly.

Materials and methods

The Animal Care and Use Committee of the Southwest University of Science and Technology (Mianyang, China) approved the experimental procedures used in this study (SMo0256). In this experiment, the grape seed extract was provided by Nanjing Zhenweikang Biotechnology Co., Ltd., and extracted according to 10:1. VE was purchased from Sichuan Youjia Biological Technology Co., LTD, the 1-day-old broilers were purchased from Sichuan Shengdile Village Ecological Food Co., Ltd.

Birds and diets

Two hundred and sixteen 1-d-old male Ross 308 broiler chicks with an average initial BW (body weight) of 42.17 ± 4.53 g per chick were randomly allotted to 3 treatments with six replicates each. Experimental diets were as follows: 1) the diet supplemented with oxidized rice bran oil (CN group); 2) the diet supplemented with oxidized rice bran oil and 25 mg/kg VE (VE group); 3) the diet supplemented with oxidized rice bran oil and 100 mg/kg GSE (GSE group). The experiment lasted for six weeks.

Experimental design and diets

All diets were formulated to meet or exceed the nutrient requirements recommended by the NRC guidelines (1994). The compositions of the basal diets are shown in Table 1 and are designed for the starter phase (1–21 d) and grower phase (22–42 d).

Table 1. Ingredient and nutrient composition of the basal diets (air dry basis).

Ingredients, %	Starter phase	Finisher phase
Maize	47.35	50.15
Soybean meal (43% CP)	30.30	26.20
Wheat	10.00	10.00
DDGS (7% CP)	3.00	3.00
Cottonseed Meal (46% CP)	3.00	3.00
Oxidized Rice Bran oil	2.50	3.95
Limestone	1.30	1.35
Dicalcium phosphate	1.50	1.25
Salt	0.32	0.32
L- lysine HCl 78%	0.26	0.28
DL-methionine	0.13	0.14
Vit -Min premixes^1	0.35	0.36
Total	100.00	100.00
Composition^2, %
ME, Kcal/kg	2901.46	3023.35
CP	20.54	19.01
Ca	0.94	0.90
Total P	0.65	0.59
Available P	0.40	0.35
SID Lys	1.00	0.92
SID Met	0.40	0.39
SID Met + Cys	0.73	0.70

¹ Provided the following per kilogram of diet: 12,000 IU of vitamin A, 2,500 IU of vitamin D₃, 2.6 mg of vitamin K, 25 mg of vitamin E, 2.2 mg of vitamin B₁, 7.6 mg of vitamin B₂, 4 mg of vitamin B₆, 40 mg of nicotinic acid, and 1.2 mg of folic acid. 80 mg of Fe, 8 mg of Cu, 65 mg of Zn, 110 mg of Mn, and 0.35 mg of Se.

² Metabolizable energy (ME) is calculated according to the Chinese Feed Composition and Nutritional Value Table (30th Edition in 2019), and the CP, Ca, and Total P are measured values. Measured values are the average values of triplicate measurements. The remaining values are calculated.

³ DDGS: distillers dried grains with soluble; ME: metabolizable energy; CP: crude protein; Ca: calcium; Total P: Total phosphorus; Available P: Available phosphorus; SID Lys: standard ileal digestible lysine; SID Met: standard ileal digestible methionine; SID Met + Cys: standard ileal digestible methionine and cystine.

All the birds were housed in stainless steel pens with concrete floors covered with clean rice husk under standard temperature, humidity, and ventilation conditions. Feed and water were provided ad libitum. Oxygenized rice bran oil was added to the diet consistently in all diets (Table 1).

Oxidized oil was prepared according to method of Dong et al., 2020 with some modifications.⁵ Fresh rice bran oil was heated in water baths to 40 °C for 6 days with continuous aeration. The malondialdehyde value in fresh oil was 0.4 mg/kg, and in the oxidized oil, it was 3.4 mg/kg (Table 2). Fresh rice bran oil was stored at −20 °C until it was used preparing the diets. Then, the processed oil and fresh oil were cooled down to room temperature before feed preparation, and the peroxide value was 223.54 meq/kg, with 3.13 meq/kg for the fresh oil (Table 2).

Table 2. Analysis of fresh and oxidized rice bran oil composition.

Items	Fresh rice bran oil	Oxidized rice bran oil
C14:0, %	0.34	0.36
C15:0, %	0.04	0.04
C16:0, %	15.28	15.30
C16:In7, %	0.15	0.15
C18:0, %	1.98	1.97
C18:In9c, %	35.90	35.60
C18:2n6c, %	28.41	28.20
C20:0, %	0.89	0.88
C18:3n3, %	1.86	1.83
C22:0, %	0.45	0.42
C24:0, %	0.84	0.76
Peroxide value, meq/kg	3.13	223.54
MDA, mg/kg	0.40	3.40
Acid Value, mg KOH/g	2.30	9.40

Sampling and measurements

At the end of the experiment, one bird from each cage (replicate) with a BW close to the replicate means (six birds for each treatment in total) was selected for sampling. The blood samples were collected from the wing vein on d 43. Serum samples were collected after being centrifuged at 3000 × g for 15 min and stored at −20 °C to determine serum biochemical and antioxidant indices. The same broilers were sacrificed by cervical dislocation after blood sampling. After opening the abdomen, trained personnel removed the liver and stored it at −80 °C to determine antioxidant indices and antioxidant-related genes.

Growth performance determination

Feed intake was checked daily during the experiment. Body weight was reviewed on d 0, 22, and 43. Average daily feed intake (ADFI), body weight gain (BWG), and body weight gain (F/G) were then calculated using this information.

Biochemical indices

Six serum biochemical indices, alanine transaminase (ALT), aspartate transaminase (AST), gamma-glutamyl transpeptidase (GGT), total protein (TP), albumin (ALB), globulin (GLB), and total bilirubin (TBIL) were determined using an automatic biochemistry analyzer (Hitachi 7020, Japan).

Antioxidant indices

The levels of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px), glutathione S-transferase (GST), total antioxidant capacity (T-AOC), malondialdehyde (MDA) in the serum and liver were analyzed using specific commercial assay kits (Jiancheng Bioengineering Institute, Nanjing, China) following the kit instructions.

RNA extraction and gene expression analysis

Frozen liver tissue (0.1 g) was homogenized in 1 ml TRIzol reagent (Invitrogen), and total RNA was extracted following the manufacturer’s instructions. The concentration and purity of RNA were calculated by measuring the concentration of the plasmid using spectrophotometrically (Beckman Coulter DU800; Beckman Coulter, Inc), and the OD260: OD280 ratio (where OD is the optical density) ranged from 1.8 to 2.0 for all sample. The integrity of RNA was checked by electrophoresis on a 1.5% agarose gel. According to the manufacturer’s instructions, the RNA samples were reverse-transcribed into complementary DNA using the Prime Scripte RT reagent kit (Takara). The primers were synthesized commercially by Life Technologies Limited and are listed in Table 3. Real-time PCR for quantification of nuclear factor E2 related factor 2 (Nrf2), heat shock protein 70 (HSP70), catalase (CAT), heme oxygenase-1 (HO-1), superoxide dismutase-1 (SOD-1) was carried out on the Opticon DNA Engine (Bio-Rad) using SYBR Green PCR reagents (Takara). B-Actin was chosen as the reference gene, and the relative expression ratio of the target gene in comparison with the reference gene was calculated as described previously. Each standard and sample were run simultaneously in duplicate on the same PCR plate. The average value of each duplicate, expressed as the number of copies, was used for statistical analysis.

Table 3. Primer sequences used for real-time PCR.

Target Gene	Nucleotide sequences 5ˊ-3ˊ	Annealing temperature (°C)	Product length (bp)	Accession number
β-actin	F: CTGACTGACCGCGTTACTCC	60.0	84	NM_205518.1
	R: TTGCACATACCGGAGCCATT
Nrf2	F: AGAAAACGCTGAACCACCAATC	60.0	217	NM_205117.1
	R: GCTGGGTGGCTGAGTTTGATTA
HSP70	F: TGCTATTGCCTATGGCTTGGAT	60.0	221	NM_001006685.1
	R: GCTTGTGCTTACCCTTGAACTCTT
CAT	F: GTTTCCATCCTTCATCCATAGCC	60.0	151	NM_001031215.2
	R: GCGAAATCCATCAGG AATACCA
HO-1	F: TGTCCCTCCACGAGTTCAAGC	60.0	301	NM_205344.1
	R: GACAGGTCTCCCAAATAGCGG
SOD-1	F: TTGTCTGATGGAGATCATGGCTTC	60.0	98	NM_205064.1
	R: TGCTTGCCTTCAGGATTAAAGTGAG

Statistical analysis

Data were statistically analyzed using the Mixed procedures of SAS (SAS Inst. Inc., Cary, NC), with the replicate being defined as the experimental unit. Differences among the three experimental groups were examined using Duncan’s multiple comparisons. P < 0.05 was used as the criterion for statistical significance. Variability in the data is expressed as the standard error means (SEM).

Results

Growth performance

From days 22 to 42 and days 1 to 42, compared with the VE and GSE groups, the CN group significantly decreased ADFI and BWG (P < 0.05) and increased the F/G of chicks (P < 0.05), as shown in Table 4.

Table 4. Effect of feeding grape seed extract on growth performance of broilers¹.

Items^2	VE	CN	GSE	SEM	P-value
1 ∼ 21 d
ADFI, g/d	54.23	51.87	54.18	0.25	0.67
BWG, g/d	41.60	40.27	42.65	0.26	0.32
F/G	1.31	1.30	1.27	0.04	0.07
22 ∼ 42d
ADFI, g/d	161.43^a	141.72^b	162.83^a	0.85	<0.01
BWG, g/d	85.88^a	65.55^b	95.23^a	1.25	<0.01
F/G	1.89^b	2.18^a	1.74^b	0.18	<0.01
1 ∼ 42d
ADFI, g/d	107.85^a	96.80^b	108.53^a	0.42	<0.01
BWG, g/d	63.73^a	52.93^b	68.95^a	0.92	<0.01
F/G	1.70^b	1.83^a	1.59^c	0.07	<0.01
Survival rate, %	98.6	98.6	100

¹ This study used 216 broiler chicks randomly into three groups with six replicates containing 12 birds each. Means within a row with different letters differ significantly (P < 0.05).

² ADFI: average daily feed intake; BWG: body weight gain; F/G: ADFI/BWG; VE: vitamin E group; CN: control group; GSE: grape seed extract group.

Serum biochemical indices

As shown in Table 5, Compared with the CN group, the VE and GSE groups decreased ALT, GGT, and AST activities and decreased TBIL concentration (P < 0.05).

Table 5. Effect of feeding grape seed extract on biochemical indexes of broilers¹.

Items^2	VE	CN	GSE	SEM	P-value
ALT, U/L	7.72^b	13.25^a	8.20^b	0.63	<0.01
AST, U/L	431.19^b	736.23^a	461.61^b	34.32	<0.01
GGT, U/T	14.93^b	21.99^a	13.39^b	1.06	0.01
TP, g/L	29.23	26.69	31.21	0.69	0.06
ALB, g/L	14.93	12.92	13.99	0.29	0.08
GLB, g/L	18.17	15.67	17.22	0.43	0.14
TBIL, g/L	8.14^b	11.59^a	7.99^b	0.31	<0.01

¹ Each mean represents six replicate pens. Means within a row with different letters differ significantly (P < 0.05).

² ALT: alanine aminotransferase; AST: aspartate aminotransferase; TP: total protein; ALB: albumin; GLB: globulin; GGT: gamma-glutamyl transpeptidase; TBIL: total bilirubin; VE: vitamin E group; CN: control group; GSE: grape seed extract group.

Serum and liver antioxidant indices

Table 6 shows the serum and liver antioxidant indices of broilers. Compared with the CN group, the VE and GSE groups increased MDA concentration (P < 0.05) and decreased GSH-Px and T-AOC activities (P < 0.05) in serum. Compared with the CN group, the VE and GSE groups increased MDA concentration (P < 0.05) and decreased GSH-Px activities (P < 0.05) in the liver. Compared with the CN group, the VE group increased T-AOC activities (P < 0.05) in the liver.

Table 6. Effect of feeding grape seed extract on the antioxidant index of broilers¹.

Items^2	VE	CN	GSE	SEM	P-value
Serum
SOD, U/mg	577.53	477.7	601.15	32.65	0.54
MDA, nmol/mg	2.16^b	3.20^a	2.48^b	0.09	<0.01
GSH-Px, μg/mg	1176.67^a	663.33^b	1043.33^a	62.02	<0.01
CAT, U/mg	3.37	2.28	3.71	0.32	0.48
T-AOC, U/mg	1.10^a	0.82^b	1.12^a	0.01	<0.01
Liver
SOD, U/mg	1184.83	1097.87	1226.30	293.54	0.83
MDA, nmol/mg	0.24^b	0.40^a	0.25^b	0.07	<0.01
GSH-Px, μg/mg	88.55^b	27.08^c	98.50^a	20.97	<0.01
CAT, μg/mg	4.28	6.80	9.65	1.21	0.78
T-AOC, U/mg	0.11^a	0.05^b	0.10^ab	0.03	<0.01

¹ Each mean represents five replicate pens. Means within a row with different letters differ significantly (P < 0.05).

² SOD: superoxide dismutase; MDA: malondialdehyde; GSH-PX: glutathione peroxidase; CAT: catalase; T-AOC: total antioxidant capacity; VE: vitamin E group; CN: control group; GSE: grape seed extract group.

Liver antioxidant-related gene

Table 7 shows the effect of feeding grape seed extract on antioxidant-related gene mRNA in the liver of broilers. Compared with the VE group, the mRNA level of Nrf2, HSP70, CAT, HO-1, and SOD1 in the liver of the CN group was decreased (P < 0.05). Compared with the CN group, the mRNA level of Nrf2, CAT, and HO-1 in the liver of the GSE group was upregulated (P < 0.05).

Table 7. Effect of feeding grape seed extract on antioxidant-related gene mRNA of broilers¹.

Items^2	VE	CN	GSE	SEM	P-value
Nrf2	1.00^a	0.29^c	0.59^b	0.14	0.03
HSP70	1.00^a	0.16^b	0.33^ab	0.22	<0.01
CAT	1.00^a	0.21^c	1.01^a	0.12	0.03
HO-1	1.00^b	0.50^c	1.28^a	0.07	0.03
SOD-1	1.00^a	0.43^b	0.66^ab	0.10	0.05

¹ Each mean represents five replicate pens. Means within a row with different letters differ significantly (P < 0.05).

² SOD-1: superoxide dismutase; MDA: malondialdehyde; GSH-Px: glutathione peroxidase; CAT: catalase; T-AOC: total antioxidant capacity; VE: vitamin E group; CN: control group; GSE: grape seed extract group.

Discussion

In terms of growth performance. The CN group exhibited inferior results compared to the VE group, which is consistent with the findings of Hu et al. (2015), Lu et al. (2014), and Pitargue et al. (2019).^17–19 The oxidized rice bran oil displayed higher MDA concentration and lower unsaturated fatty acid content than fresh rice bran oil, indicating poor quality.⁵ Gao et al. (2012) also reported lesser weight gain in red sea bream Pagrus major-fed oxidized oil compared to the fishes fed fresh oil.²⁰ Reduced weight gain in animals might be due to the destruction of fat-soluble vitamins in oxidized oil and oxidation products. This leads to reduced availability of nutrients and immunity and consequently depressed growth performance.³ Vitamin E is an essential nutrient that protects organisms against lipid oxidation.²¹ The groups supplemented with grape seed extract showed improved growth performance, possibly due to its antioxidant effect that prevents the toxic effects of free radicals. Jafari et al. (2021) reported that antioxidant plant extracts could improve the growth performance of broiler chickens fed diets containing oxidized oil.²² In this experiment, adding grape seed extract to the diet improved feed efficiency more effectively than excessive vitamin E. These improvements may be due to grape seed extract’s increased villus height, porous surface area, enzyme expression, and nutrient transport systems resulting from improved feed efficiency.²³ Or they may be due to natural antioxidants that can protect the intestinal mucosa against oxidative damage and pathogens. They also limit peristaltic activity in digestive disorders and reduce intestinal movement, leading to better nutrient absorption.²⁴ The study results showed that adding vitamin E or grape seed extract improved the growth performance of broilers fed oxidized rice bran oil.

Feeding oxidized fats can induce oxidative stress in broilers, leading to excessive generation of free radicals and subsequent lipid peroxidation within the body. This process disrupts the structure of cell biofilms, triggers lysosomes to release hydrolytic enzymes, and ultimately results in cellular autolysis, liver cell rupture, and leakage of intracellular contents.²⁵ Modifications in the levels of ALT, AST, GGT, and TBIL are considered crucial biomarkers indicative of liver dysfunction.²⁶ The administration of oxidized rice bran oil serum resulted in higher levels of AST, ALT, GGT, TBIL, and other indices compared to the administration of fresh rice bran oil, which indicates that oxidized rice bran oil could damage liver function.²⁷ Supplementation of GSE or VE in the diet significantly affected serum biochemical indexes. This finding was consistent with previous reports on chickens.^24,25 Hamza et al.²⁸ believed that oxidative stress is crucial in producing lethal hepatocyte injury.²⁸ Vitamin E possesses antioxidant properties and regulates liver function through inflammatory responses, gene expression, membrane-bound enzymes, cell signaling, and cell proliferation. This study found that supplementation of GSE or vitamin E significantly reverts the disturbed levels of liver antioxidant enzymes. Grape seed extract or vitamin E supplementation reduced liver damage.

Oxidized oils may lead to an imbalanced oxidative and antioxidant effect in broilers, which can result in the body being in a state of oxidative stress.^15,22,29 Several studies have indicated that grape seed extract and vitamin E may improve the antioxidant capacity in broilers.^13,16,25 The antioxidant potential of grape seed polyphenols has been reported to be 20 times greater than that of vitamin E and 50 times greater than that of vitamin C, respectively.¹¹ Our study also confirmed that GSE and VE could exert antioxidative activities by improving GSH-Px and T-AOC serum levels and decreasing serum MDA. Almusawi et al.²⁹ reported that the addition of 200 mg/kg GSE to the diet can improve the antioxidant capacity of broilers,²⁹ which may be attributed to the phytochemicals that present in grapes hold an antioxidant action and the action in the GSE is associated with whole phenolic contents.³⁰ The Keap1-Nrf2/ARE signaling pathway is involved in resisting external oxidative stress, which is not only an important defense system against oxidative damage but also a critical signaling pathway to enhance the body’s antioxidant capacity.³¹ Grape seed extracts are a kind of natural antioxidant, which can enhance the body’s ability to resist ROS or RNS, but their antioxidant mechanisms are complex.²⁴ With the continuous development of the separation and purification technology of grape seed extract, more grape seed polyphenols have been found, and these antioxidants are all related to the Keapl-Nrf2/ARE signaling pathway.³² Zhou et al.³³ believe that polyphenols possess Nrf2 activation, not only inhibit the production of ROS and inhibit Keap1-Nrf2 protein interaction but also degrade Keap1 and regulate the Nrf2-related pathway.³³ Palsamy et al.³⁴ demonstrated that GSE normalized renal expression of Nrf2/Keap1 and its downstream regulatory proteins in diabetic rats.³⁴ In this experiment, compared with the control group, the mRNA expressions of Nrf2, SOD-1, CAT, and HO-1 were increased in the liver of broilers fed with VE and GSE. This is consistent with previous research.^11,16 The liver function improvement action of the polyphenols present in GSE may contribute to the enhancement of the antioxidant capacity of the broiler liver through activation of the Keap1-Nrf2/ARE signaling pathway.

Conclusion

In conclusion, dietary supplementation with grape seed extract or vitamin E can improve growth performance, liver function, and antioxidant status and regulate the Nrf2-related pathway of Ross 308 broilers subjected to excessive intake of oxidized oils.

Disclosure statement

We certify no conflict of interest with any financial organization regarding the material discussed in the manuscript.

Data availability statement

The datasets used and analyzed during the current study are available from the corresponding author upon reasonable request.

Additional information

Funding

There is no project support for this study.