Dynamics of anthocyanin profiles of the fruits of four blueberry (Vaccinium sp.) cultivars during different growth stages

ABSTRACT

Blueberries are particularly rich in anthocyanins and are favored extensively for their health benefits. In this study, the anthocyanin profiles of fruits of four blueberry cultivars (Gardenblue, Legacy, Misty, and Brightwell) were investigated. Total anthocyanin content gradually increased in all four cultivars during development, but mature fruits of Brightwell and Gardenblue had a higher anthocyanin content than those of Legacy and Misty. Thirty-two kinds of anthocyanins were quantified using UPLC-ESI-MS/MS. Principal component analysis showed that the anthocyanin profiles of Gardenblue and Legacy were similar to those of Misty and Brightwell, respectively. Levels of malvidin 3-O-galactoside, malvidin 3-O-glucoside, malvidin 3-O-rutinoside, delphinidin 3-O-glucoside, delphinidin 3,5-O-diglucoside(delphin), petunidin 3-O-glucoside, and petunidin 3-O-rutinoside in mature fruits of Gardenblue were higher than those in the other three cultivars. The content of delphinidin 3-O-(6”-O-malonyl)-beta-D-glucoside, petunidin 3-O-(6-O-malonyl-beta-D-glucoside), petunidin 3-O-arabinoside, delphinidin 3-O-arabinoside, and delphinidin 3-O-galactoside was the highest in mature fruits of Misty. Levels of petunidin 3,5-diglucoside and petunidin 3-O-galactoside in mature fruits of Brightwell were higher than those in the other three cultivars. Quantitative real-time reverse transcription-polymerase chain reaction analysis showed that ANS, F3ʹ5’H, and UFGT were preferentially expressed in fruits of Gardenblue, possibly attributing to higher levels of delphinidin 3-O-glucoside and delphinidin 3,5-O-diglucoside (delphin) in this cultivar. This study adds to our knowledge of anthocyanin content and profiles in the four important blueberry cultivars grown in China.

Graphical abstract

KEYWORDS:

• Blueberry
• anthocyanins
• UPLC-ESI-MS/MS
• qRT-PCR

Introduction

Blueberry (Vaccinium sp.) is one of the most popular fruits in North America and is rich in anthocyanins. As a functional food and dietary supplement, it has gradually become a part of the daily diet.^[1] Its anthocyanin content contributes to beneficial effects against several oxidative stress-related diseases, including cardiovascular disorders, neurodegenerative diseases, diabetes, and cancer. ^[1–3] Increased research in diets has gained the attention of the scientific community owing to their crucial role in health, as well as in disease treatment and prevention. Therefore, the anthocyanin profiles of blueberry are worthy of further research.

There are abundant wild blueberry relatives in China including Vaccinium uliginosum in northeast China, V. bracteatum in southwest China, and V. in Jiangnan. At present, the three main species of cultivated blueberry in China are V. angustifolium, V. ashei, and V. corymbosum. ^[4] Previous studies have demonstrated that anthocyanin accumulation is mainly related to an interaction between the cultivar and climate.^[5] Guizhou Province is the most important blueberry growing region in China. Compared to similar latitudes in the world, the Yangtze River basin in the south of China does not experience severe cold in winter and has abundant rainfall, sufficient light and heat, four distinct seasons, and a large area of acidic soil.^[6] These natural resources are similar to those in the blueberry cultivation areas in the Middle East and the south of the United States.^[7] Therefore, Guizhou has unique advantages and prospects for the cultivation of blueberry in China. Current research on blueberry in Guizhou has mainly focused on the extraction, isolation, identification, and antioxidant analyses of anthocyanins.^[8–10] However, due to limitations such as low separation efficiency, low-resolution mass spectrometry, and an incomplete database, some major anthocyanins could not be identified.^[11] The application of UPLC-HR-ESI-MS (Ultra High Liquid Chromatography-High Resolution-Electron Spray Ionization-Mass Spectrometry) was shown to not only improve the separation of anthocyanins but also identify anthocyanins more accurately.^[12] In addition, UPLC-HR-ESI-MS can be used for accurate qualitative and quantitative analyses.

Metabonomics also plays an important role in improving crop yield and food quality. ^[13,14] The metabonomic analysis is used to detect and screen metabolites with important biological significance and provides statistically significant differences between biological samples. The metabonomic analysis includes two parts: metabonomic experiments and data analysis. Data analysis includes differential metabolite screening and metabolic pathway analysis. Based on the metabonomic data obtained from experiments, sample collection and processing, metabolite extraction, and metabolite detection and analysis, we can identify metabolites and analyze the quality of sample data, and screen out different metabolites to predict and analyze the function of metabolites in samples. Previous studies have shown that the application of metabonomics in the study of anthocyanin biosynthesis has produced useful results.^[15,16] Color is also an important external quality parameter of blueberries, and anthocyanins are the major color pigments of the fruit. Therefore, the application of metabonomics in blueberry anthocyanin research would be beneficial for breeding to improve the fruit color and fruit quality of blueberry. Such knowledge will be very important to lay the foundation for blueberry industrialization in China.^[17]

Therefore, this study aimed to analyze the composition of anthocyanins in blueberries cultivated in Majiang, Guizhou, at different growth stages, and explore the biosynthesis of anthocyanins to thoroughly analyze the composition and variety of blueberry anthocyanins in Guizhou using UPLC-HR-ESI-MS and metabonomics.

Materials and methods

Chemicals and reagents

HPLC-grade acetonitrile (ACN) and methanol (MeOH) were purchased from Merck (Darmstadt, Germany). Milli-Q water (Millipore, Bradford, USA) was used for all experiments. All standards were purchased from Olchemim Ltd. (Olomouc, Czech Republic). Hydrochloric acid and formic acid were purchased from Xinyang Chemical Reagent (China). Stock solutions of standards were prepared at a concentration of 1 mg/mL in 50% MeOH and all stock solutions were stored at −20°C. Stock solutions were diluted with 50% MeOH to prepare working solutions for analysis.

Plants and fruit sampling

Four types of blueberry cultivars from two species; V. corymbosum (Legacy, Misty) and V. ashei (Brightwell, Gardenblue) were harvested and transported at 4°C from the Yisheng blueberry base of Qiandongnan Autonomous Prefecture of Guizhou Province (107°43′14″E, 26°22′52″N, Majiang, Guizhou) from March to June 2020. The young fruits were picked 5 days after fruit setting, the color-transition fruits were picked 30 days after fruit setting, and the mature fruits were picked 55 days after fruit setting. The Yishen blueberry base is located in the transition zone from Yunnan Guizhou Plateau to the hilly region of Hunan Guangxi in the east of Guizhou Province. The soil is acidic and yellow. The regions have a subtropical monsoon humid climate with an annual average temperature of 15.7°C, annual average rainfall of 1266 mm, annual sunshine of 1057 h, and a frost-free period of 293 days.

Sample preparation and extraction

The samples were stored at the School of Food and Pharmaceutical Engineering in Guiyang College at −80°C (for a maximum of three months) before use. Fruits were picked at the young fruit stage, color-transition stage, and mature stage, and randomly picked thrice for each stage (Figure 1). The freeze-dried sample was crushed using a mixer mill (MM 400, Retsch) with zirconia beads for 1.5 min at 30 Hz. Exactly, 50 mg of powder was weighed and extracted with 0.5 ml methanol/water/hydrochloric acid (799:200:1, V/V/V). The extract was vortexed for 10 min and ultrasonicated for 10 min. The extracts were centrifuged at 12,000 r and 4°C for 3 min. The extraction was repeated twice. The supernatants were collected and filtrated (PTFE, 0.22 μm; Anpel) before LC-MS/MS analysis.

Figure 1. Total anthocyanin content of the fruits of four blueberry cultivars during development A. Young fruits, fruits at veraison and mature fruits of Legacy, Misty, Brightwell and Gardenblue. B. The total anthocyanin content of similar stages of fruit development of Legacy, Misty, Brightwell and Gardenblue. Three biological replications were performed, Means ± SD are shown.

UPLC conditions

The sample extracts were analyzed using a UPLC-ESI-MS/MS system (UPLC, Shim-pack UFLC SHIMADZU CBM30A system). The analytical conditions for UPLC were as follows: column, WatersAC-QUITY BEH C18 (1.7 µm, 2.1 mm*100 mm); solvent system, water (0.1% formic acid):MeOH (0.1% formic acid); gradient program, 95:5 V/V at 0 min, 50:50 V/V at 6 min, 5:95 V/V at 12 min, hold for 2 min, 95:5 V/V at 14 min, hold for 2 min; flow rate, 0.35 mL/min; temperature, 40°C: injection volume, 2 μL. The effluent was alternatively connected to an ESI-triple quadrupole linear ion trap (QTRAP)-MS.

ESI-Q TRAP-MS/MS

LIT and triple quadrupole (QQQ) scans were acquired on a triple quadrupole-linear ion trap mass spectrometer (Q TRAP), API 6500 Q TRAP UPLC/MS/MS System, equipped with an ESI Turbo Ion-Spray interface, operating in positive and negative ion mode and controlled by Analyst 1.6.3 software (AB Sciex,). The ESI source operation parameters were as follows: an ion source, turbo spray; source temperature, 550°C; ion spray voltage, 5500 V (positive ion mode); curtain gas was set at 35 psi; collision gas was high: DP and CE for individual MRM transitions were performed with further DP and CE optimization. A specific set of MRM transitions was monitored for each period, according to the metabolites eluted within that period.

Qualitative and quantitative analysis of metabolites

The material was characterized according to the secondary spectrum information, based on the self-built database MWDB (MetWare database) and the metabolite information public database. Meanwhile, to ensure the accuracy of the qualitative analysis, the isotope signal; the repeated signals of K⁺, Na⁺, and NH⁴⁺ ions: the repetitive signals of fragment ions comprised of other substances with larger molecular weights, were all removed during the analysis. Metabolite quantification was performed using MRM analysis of QQQ mass spectrometry .^[18] In the MRM mode, the quadrupole rod first screens the precursor ions (parent ions) of the target substance and excludes ions corresponding to other substances with different molecular weights to initially eliminate interference. The precursor ions break through the collision chamber to form many fragment ions after ionization, which are filtered by QQQ to select a desired characteristic fragment ion to eliminate non-target ion interference for more accurate and reproducible quantification. Finally, after obtaining the metabolite mass spectrometry data of different samples, the peak area was integrated to reveal the mass spectrum peaks of all the substances, and the mass spectrum peaks of the same metabolites in different samples were integrated and corrected, to ensure the accuracy of the quantification.

Analysis of metabolite differences and metabolic pathways

Differential metabolites were screened by combining the multiple changes of the opls-da model.^[19] The screening criteria were as follows: select metabolites with 2 ≤ fold change ≤ 0.5. If the difference in metabolites between the control group and the test group is greater than or less than twice, then the difference is considered to be significant.

De DNA treatment and reverse transcription

RNA sample system: 6.8 μL, DNase 0.4 μL (2 U/μL), 10 x buffer (1 μL) was incubated at 37°C for 30 min and inactivated at 75°C for 10 min. Configuration system on ice bath: template RNA 10 μL, Oligo (dt) Primer (1.0 μL), Radom primer 1.0 μ 50. Centrifuged after mixing, incubated at 65°C for 5 min after centrifugation, and immediately placed in an ice bath for 5 min; Then, 5 × Reaction Buffer (4 μL), 10 mM dNTP Mix (2 μL), RiboLock RNase Inhibitior (20 U/µL) (1.0 µL), and RevertAid M-MuLV RT (200 U/µL) (1.0 µL) were added. The mixture was centrifuged at 25°C for 10 min, 42°C for 60 min, and 70°C for 5 min.

Real-Time PCR

The cDNA obtained by reverse transcription was used as the template and amplified by fluorescence quantitative PCR. The reaction system was 10 µL, in which the cDNA template was 1 µL and the upstream and downstream primers were 0.7 respectively μ 50. SYBR Green master mix 5 µL, and then make up to 10 µL with ddH₂O. The reaction conditions were: PCR 95°C for 2 min, 65°C for 5 s, 60°C for 30s, 40 cycles. Finally, qPCR was used for fluorescence quantitative analysis, and the relative expression of each differentially expressed gene was calculated by the ∆∆ CT method. The primers used are shown in Table 1.

Table 1. qRT-PCR quantitative primers

Gene name		Primers sequence
DFR	F	CGTGAAAGCCGTGCACTTTG
	R	TTGCCCACCCCTTGGTCTC
F3′H	F	GGACTTTCGGGTGTCGGAGA
	R	GGAGGATGATGGCGAGGGA
FLS	F	ACGAACTCCCCGCCCAAT
	R	CCTTCAGCCGCCGTATCA
F3ʹ5’H	F	GCAAGTGGGATGATTTGATAACGAG
	R	TGTTGGTGAGGCTAAGTGATCCG
UFGT	F	TTCCAGGGCAAGGGCACA
	R	CGATTGAGGGCAGAAAAGGC
F3H	F	TTCGAGTTGATTCCGTTCGG
	R	GTGGGGTAACCTTGGCAGC
ANS	F	TGGAAGACCAGGTCACAGCC
	R	GCTACGCCGTCAACACCACT
SAND	F	AAGCATCTCTTCATCCTGATGA
	R	GATTGTATCTTGGCAGGCAA

Bioinformatics and multivariate analysis

Principal component analysis (PCA) and hierarchical clustering analyses were performed using R (http://www.r-project.org/), as previously described .^[20] The variation analysis of total anthocyanin content and gene expression was performed using Student’s t-test.

Results and discussion

Dynamics of total anthocyanin content during fruit development of four blueberry cultivars

The changes in the total anthocyanin content of various growth stages of blueberry fruits from the cultivars Gardenblue, Legacy, Misty, and Brightwell were analyzed (Table 2 and Figure 1). At the young fruit stage, Misty (C1), Legacy (B1), and Brightwell (D1) were green, and Gardenblue (F1) was red (Figure 1a). The Gardenblue (F2) fruits were rabbit-eye colored, whereas those of Brightwell (D2), Misty (C2), and Legacy (B2) were fuchsia at veraison (Figure 1a). The mature fruits of Gardenblue (F3) and Brightwell (D3) were smaller and darker than those of Legacy (B3) and Misty (C3) (Figure 1a). Throughout development, the total anthocyanin content of Gardenblue was higher than that of Legacy, Misty, and Brightwell (Figure 1b). The young fruits of Legacy, Misty, and Brightwell had a similar anthocyanin content. At veraison, Misty and Brightwell had the same anthocyanin content, which was higher than that of Legacy (Figure 1b). The mature fruits of Legacy and Misty had a similar anthocyanin content, which was lower than that of Brightwell (Figure 1b). Overall, comparing the different growth periods of the same fruit, the anthocyanin content increased significantly with the transition from partially to fully pigmented fruit in all the analyzed cultivars. When comparing the same growth period of the different fruits, Gardenblue had the darkest color and the highest amount of anthocyanin. This is consistent with the results of a previous study.^[21]

Table 2. Content changes of anthocyanins monomers of different blueberry at different developmental stages

Name	Relative average peak area
	B1	B2	B3	C1	C2	C3	D1	D2	D3	F1	F2	F3
Cyanidin-3-o-malonyl glucoside	8.91×10^4	3.43×10^5	4.95×10^5	2.40×10^4	7.62×10^5	2.04×10^6	2.29×10^4	1.16×10^4	1.92×10^8	9.11×10^4	4.05×10^4	1.99×10^6
	±4.23×10^3	±2.54×10^4	±2.92×10^4	±3.11×10^3	±1.15×10^5	±1.79×10^5	±6.09×10^3	±2.82×10^3	±3.61×10^3	±7.95×10^3	±5.78×10^3	±1.42×10^5
Cyanidin-3-o-arabinoside	8.48×10^7	2.51×10^8	3.55×10^8	5.34×10^7	2.77×10^8	3.50×10^8	3.07×10^7	2.87×10^7	1.92×10^8	1.32×10^8	6.78×10^7	3.59×10^8
	±4.04×10^6	±3.82×10^6	±1.49×10^7	±5.45×10^6	±1.51×10^7	±6.84×10^6	±1.08×10^6	±7.50×10^6	±1.27×10^7	±3.99×10^6	±4.26×10^6	±1.83×10^6
Cyanidin-3-o-galactoside	1.34×10^8	2.83×10^8	2.57×10^8	7.73×10^7	2.53×10^8	2.53×10^8	7.44×10^7	6.49×10^7	1.00×10^8	1.82×10^8	1.14×10^8	2.20×10^8
	±4.04×10^6	±4.04×10^6	±9.67×10^6	±5.32×10^6	±2.44×10^6	±2.10×10	±1.08×10^6	±2.14×10^7	±3.13×10^6	±1.36×10^7	±4.64×10^6	±1.29×10^7
Cyanidin-3-o-glucoside	6.14×10^6	3.07×10^7	1.10×10^8	3.61×10^6	1.28×10^8	2.93×10^8	6.90×10^6	2.34×10^6	3.23×10^7	3.32×10^7	1.98×10^7	1.69×10^8
	±5.20×10^5	±2.79×10^6	±8.53×10^6	±6.88×10^5	±7.72×10^6	±1.57×10^7	±1.60×10^5	±8.38×10^5	±3.13×10^6	±3.21×10^6	±6.68×10^5	±1.57×10^7
Cyanidin-3-o-rutoside	1.32×10^5	4.29×10^5	1.15×10^6	3.14×10^4	2.93×10^5	6.07×10^5	1.45×10^6	8.66×10^4	1.36×10^7	5.98×10^6	7.67×10^5	4.11×10^6
	±9.15×10^3	±4.88×10^4	±9.47×10^4	±2.12×10^3	±2.49×10^4	±4.77×10^4	±6.78×10^4	±2.48×10^3	±1.39×10^5	±4.21×10^5	±2.65×10^4	±2.85×10^5
Delphinidin-3,5-o-diglucoside	9.00	1.39×10^6	1.28×10^7	9.00	9.92×10^5	8.31×10^6	9.00	9.00	9.90×10^7	9.00	9.00	1.45×10^7
	±0.00	±1.07×10^5	±1.23×10^6	±0.00	±7.13×10^4	±2.55×10^6	±0.00	±0.00	±1.29×10^6	±0.00	±0.00	±6.62×10^5
Delphinidin-3-o-malonyl glucoside	1.92×10^4	2.64×10^4	3.81×10^5	1.31×10^4	7.07×10^5	4.23×10^6	9.00	2.36×10^4	1.06×10^8	1.63×10^4	4.60×10^4	4.49×10^5
	±2.39×10^3	±1.18×10^3	±1.97×10^4	±6.74×10^2	±4.26×10^4	±5.93×10^5	±0.00	±7.45×10^3	±1.61×10^3	±8.86×10^2	±2.29×10^3	±1.15×10^4
Delphinidin-3-o-arabinoside	9.00	1.52×10^7	2.27×10^8	9.00	7.39×10^7	2.68×10^8	9.00	9.00	2.22×10^8	9.00	9.00	1.70×10^8
	±0.00	±3.34×10^6	±8.21×10^6	±0.00	±1.41×10^6	±2.03×10^7	±0.00	±0.00	±5.21×10^6	±0.00	±0.00	±4.31×10^6
Delphinidin-3-o-galactoside	1.79×10^6	2.81×10^8	3.57×10^8	9.72×10^5	3.45×10^8	4.44×10^8	5.73×10^5	1.65×10^5	2.96×10^8	2.99×10^5	1.38×10^5	3.26×10^8
	±6.76×10^4	±2.32×10^7	±6.94×10^6	±1.09×10^5	±8.87×10^6	±2.47×10^7	±1.20×10^5	±7.06×10^4	±3.77×10^6	±3.89×10^4	±3.29×10^4	±2.54×10^7
Delphinidin-3-o-glucoside	5.77×10^5	1.33×10^7	2.20×10^8	1.25×10^5	2.71×10^8	2.45×10^8	6.77×10^5	3.85×10^5	2.48×10^8	5.31×10^5	3.35×10^5	2.66×10^8
	±8.40×10^4	±3.16×10^6	±7.97×10^6	±3.03×10^4	±6.03×10^6	±6.25×10^6	±1.65×10^4	±1.26×10^4	±5.78×10^6	±4.93×10^4	±3.58×10^4	±5.19×10^6
Malvidin-3-o-arabinoside	2.36×10^6	2.25×10^8	5.29×10^8	1.04×10^6	3.00×10^8	4.60×10^8	6.48×10^6	2.21×10^5	2.40×10^8	9.39×10^5	2.30×10^5	5.19×10^8
	±3.67×10^5	±1.56×10^7	±1.36×10^7	±7.10×10^5	±1.97×10^7	±1.20×10^7	±1.03×10^6	±3.82×10^4	±4.81×10^6	±6.17×10^5	±2.71×10^4	±1.19×10^7
Malvidin -3-o-galactoside	9.59×10^6	3.91×10^8	3.95×10^8	2.76×10^6	4.17×10^8	3.37×10^8	3.45×10^7	5.92×10^5	1.24×10^8	3.05×10^6	9.51×10^5	4.48×10^8
	±3.48×10^5	±1.46×10^7	±2.77×10^7	±1.26×10^5	±2.21×10^6	±1.79×10^7	±4.50×10^6	±1.90×10^4	±9.64×10^6	±1.78×10^5	±1.17×10^4	±3.66×10^7
Malvidin -3-o-glucoside	6.80×10^6	2.96×10^7	2.39×10^8	1.26×10^6	3.03×10^8	3.68×10^8	1.42×10^7	6.39×10^5	4.04×10^7	5.80×10^5	8.07×10^5	4.90×10^8
	±3.11×10^5	±4.08×10^6	±2.66×10^6	±3.11×10^4	±1.97×10^7	±1.85×10^7	±2.17×10^6	±1.20×10^5	±2.77×10^6	±3.85×10^4	±5.27×10^4	±1.34×10^7
Malvidin -3-o-rutoside	8.21×10^3	5.82×10^5	1.91×10^6	9.00	8.79×10^5	2.45×10^6	3.33×10^4	9.00	5.03×10^6	9.00	9.00	8.03×10^6
	±9.10×10^2	±6.76×10^4	±1.21×10^5	±0.00	±1.19×10^5	±1.08×10^5	±3.51×10^3	±0.0	±1.76×10^4	±0.00	±0.00	±3.20×10^5
Pelargonidin -3-o-malonyl glucoside	9.00	9.00	6.01×10^3	9.00	4.58×10^3	3.01×10^4	9.00	9.00	5.18×10^6	9.00	9.00	1.22×10^5
	±0.00	±0.00	±4.92×10^2	±0.00	±2.33×10^2	±1.83×10^3	±0.00	±0.00	±5.02×10^2	±0.00	±0.00	±6.20×10^3
Pelargonidin -3-o-arabinoside	1.07×10^5	9.37×10^5	4.15×10^6	3.45×10^4	1.01×10^6	3.82×10^6	5.38×10^4	4.28×10^4	5.18×10^6	1.61×10^5	5.33×10^4	8.61×10^6
	±7.65×10^3	±7.35×10^4	±3.76×10^5	±6.78×10^3	±6.43×10^4	±7.13×10^5	±1.94×10^3	±1.27×10^3	±1.10×10^5	±1.01×10^4	±7.88×10^3	±3.21×10^5
Pelargonidin -3-o-galactoside	1.44×10^5	1.21×10^6	3.35×10^6	5.16×10^4	1.05×10^6	2.97×10^6	1.51×10^5	7.99×10^4	2.51×10^6	2.35×10^5	1.04×10^5	7.81×10^6
	±5.48×10^3	±3.99×10^4	±2.42×10^5	±7.18×10^3	±6.90×10^4	±4.88×10^5	±9.03×10^3	±2.46×10^3	±1.08×10^5	±1.50×10^4	±5.13×10^3	±4.53×10^5
Pelargonidin -3-o-glucoside	9.00	1.07×10^5	5.61×10^5	9.00	6.42×10^5	3.47×10^6	9.00	9.00	2.21×10^5	3.06×10^4	2.57×10^4	2.33×10^7
	±0.00	±1.15×10^4	±1.92×10^4	±0.00	±3.42×10^4	±7.41×10^5	±0.00	±0.00	±7.21×10^4	±3.35×10^3	±1.22×10^3	±1.88×10^6
Pelargonidin -3-o-rutoside	7.75×10^4	1.22×10^5	1.02×10^4	6.40×10^5	4.46×10^5	7.43×10^4	1.17×10^4	1.08×10^5	2.84×10^4	2.47×10^5	4.12×10^5	4.70×10^4
	±1.72×10^3	±9.72×10^4	±2.42×10^3	±2.18×10^4	±2.90×10^4	±1.67×10^3	±6.81×10^2	±5.50×10^4	±7.93×10^3	±4.69×10^4	±9.40×10^4	±4.76×10^3
Pelargonidin -3,5-o-diglucoside	1.38×10^4	9.00	9.00	1.20×10^4	9.00	9.00	2.03×10^4	9.00	2.47×10^7	3.59×10^4	9.71×10^3	9.00
	±1.17×10^3	±0.00	±0.00	±1.20×10^3	±0.00	±0.00	±3.93×10^3	±0.00	±1.72×10^5	±3.38×10^3	±2.93×10^3	±0.00
Peonidin -3,5-o-diglucoside	9.00	9.00	9.95×10^3	9.00	4.81×10^3	1.71×10^4	6.74×10^3	9.00	1.20×10^8	9.00	9.00	2.20×10^5
	±0.00	±0.00	±3.51×10^2	±0.00	±6.55×10^2	±2.23×10^2	±9.91×10^2	±0.00	±2.45×10^3	±0.00	±0.00	±1.85×10^4
Peonidin -3-o-malonyl glucoside	9.00	1.14×10^4	1.10×10^5	9.00	6.11×10^4	5.33×10^5	2.20×10^3	9.00	2.03×10^8	2.65×10^3	1.05×10^3	1.17×10^6
	±0.00	±3.53×10^2	±6.57×10^3	±0.00	±7.42×10^3	±7.75×10^4	±3.67×10^2	±0.00	±3.99×10^3	±6.63×10^1	±4.75×10^1	±8.31×10^4
Peonidin -3-o-glucoside	1.86×10^6	1.24×10^7	4.20×10^7	3.50×10^5	9.34×10^7	2.23×10^8	6.95×10^6	1.21×10^5	2.03×10^8	6.58×10^6	3.18×10^6	3.28×10^8
	±7.69×10^5	±2.96×10^5	±1.71×10^6	±2.77×10^4	±1.19×10^6	±1.47×10^7	±7.77×10^5	±3.11×10^4	±1.26×10^6	±3.93×10^5	±5.46×10^5	±6.01×10^6
Peonidin -3-o-arabinoside	3.09×10^6	7.03×10^7	3.08×10^8	9.68×10^5	9.52×10^7	2.27×10^8	2.12×10^6	2.89×10^5	1.78×10^8	1.14×10^7	2.84×10^6	2.72×10^8
	±1.28×10^5	±7.04×10^6	±8.64×10^6	±1.37×10^5	±7.69×10^6	±2.00×10^7	±2.31×10^5	±1.30×10^4	±1.84×10^7	±5.73×10^5	±3.65×10^5	±8.91×10^6
Peonidin -3-o-galactoside	6.49×10^6	1.36×10^8	3.13×10^8	2.13×10^6	1.52×10^8	2.58×10^8	7.86×10^6	7.94×10^5	8.33×10^7	2.24×10^7	8.39×10^6	3.17×10^8
	±5.04×10^5	±1.45×10^7	±5.25×10^6	±3.13×10^4	±4.85×10^6	±1.64×10^7	±1.26×10^5	±2.91×10^4	±1.41×10^6	±1.79×10^6	±8.67×10^5	±8.37×10^6
Peonidin -3-o-rutoside	2.02×10^4	2.73×10^5	1.46×10^6	9.00	2.43×10^5	7.32×10^5	9.53×10^4	9.00	9.21×10^7	1.88×10^6	1.69×10^5	5.25×10^6
	±1.27×10^2	±1.51×10^4	±5.76×10^4	±0.00	±1.74×10^4	±8.95×10^4	±5.47×10^3	±0.00	±1.11×10^5	±1.45×10^5	±6.75×10^3	±3.90×10^5
Petunia-3,5-o-diglucoside	9.00	9.00	1.71×10^4	9.00	9.00	1.16×10^4	9.00	9.00	1.60×10^8	9.00	9.00	3.76×10^4
	±0.00	±0.00	±2.08×10^3	±0.00	±0.00	±4.63×10^2	±0.00	±0.00	±9.69×10^3	±0.00	±0.00	±8.70×10^3
Petunia-3-o-malonyl glucoside	9.00	5.89×10^4	9.47×10^5	1.32×10^4	8.23×10^5	7.50×10^6	9.00	9.00	1.79×10^8	9.00	9.00	2.58×10^6
	±0.00	±9.76×10^3	±2.74×10^4	±1.78×10^3	±1.17×10^5	±6.16×10^5	±0.00	±0.00	±1.62×10^3	±0.00	±0.00	±1.00×10^5
Petunia-3-o-arabinoside	5.11×10^5	2.14×10^8	4.24×10^8	7.08×10^5	3.69×10^8	4.59×10^8	1.05×10^6	1.81×10^5	1.79×10^8	4.33×10^5	1.14×10^5	4.06×10^8
	±9.45×10^4	±2.78×10^7	±1.44×10^7	±5.76×10^4	±1.08×10^7	±1.30×10^7	±5.80×10^5	±3.51×10^4	±8.43×10^6	±2.35×10^4	±2.66×10^4	±1.99×10^7
Petunia-3-o-galactoside	9.49×10^5	2.51×10^8	1.87×10^8	9.63×10^5	3.00×10^8	1.83×10^8	1.12×10^6	1.83×10^5	8.71×10^7	4.91×10^5	1.50×10^5	1.60×10^8
	±2.48×10^4	±1.13×10^7	±9.81×10^6	±6.51×10^4	±6.21×10^6	±1.92×10^7	±3.23×10^5	±7.04×10^4	±1.31×10^6	±2.33×10^4	±2.00×10^4	±8.72×10^6
Petunia 3-o-glucoside	9.00	2.55×10^7	2.35×10^8	9.00	3.14×10^8	3.67×10^8	1.24×10^6	1.06×10^5	1.84×10^7	9.00	9.00	3.85×10^8
	±0.00	±3.43×10^6	±3.90×10^6	±0.00	±6.84×10^6	±7.43×10^6	±6.72×10^5	±4.97×10^4	±7.84×10^6	±0.00	±0.00	±6.55×10^6
Petunia-3-o-rutoside	9.00	3.31×10^4	1.56×10^5	9.00	5.49×10^4	1.45×10^5	9.00	9.00	3.16×10^6	9.00	9.00	3.34×10^5
	±0.00	±3.53×10^3	±1.24×10^4	±0.00	±2.49×10^3	±1.82×10^4	±0.00	±0.00	±2.06×10^3	±0.00	±0.00	±1.88×10^4
Procyanidins A1	9.00	4.83×10^4	8.34×10^3	4.71×10^4	9.47×10^4	4.84×10^4	1.89×10^4	1.88×10^5	4.72×10^6	3.07×10^5	6.41×10^5	4.86×10^5
	±0.00	±5.84×10^3	±1.64×10^2	±1.55×10^3	±1.45×10^3	±1.40×10^3	±7.13×10^3	±7.52×10^4	±1.30×10^5	±5.26×10^3	±6.72×10^4	±7.00×10^4
Procyanidins A2	1.68×10^4	1.08×10^5	1.41×10^4	1.90×10^5	8.30×10^4	3.46×10^4	4.15×10^4	2.98×10^5	4.82×10^6	1.24×10^6	1.38×10^6	4.90×10^5
	±3.14×10^3	±9.51×10^4	±2.09×10^3	±6.76×10^4	±2.43×10^3	±4.11×10^3	±1.25×10^4	±1.31×10^4	±1.69×10^5	±1.73×10^5	±7.40×10^4	±6.11×10^4
Procyanidins B1	1.22×10^7	2.48×10^7	5.54×10^6	4.81×10^7	1.03×10^8	5.71×10^7	1.26×10^6	1.86×10^7	4.76×10^6	1.30×10^7	2.89×10^7	1.05×10^7
	±1.89×10^6	±9.13×10^6	±2.20×10^5	±7.83×10^6	±9.14×10^5	±1.96×10^6	±1.33×10^5	±9.01×106	±4.10×10^5	±1.83×10^6	±5.47×10^6	±7.83×10^5
Procyanidins B2	1.47×10^7	2.86×10^7	3.00×10^6	4.67×10^7	6.58×10^7	2.90×10^7	5.33×10^5	7.45×10^6	1.39×10^7	1.05×10^7	2.21×10^7	8.70×10^6
	±1.89×10^6	±1.37×10^6	±1.97×10^5	±8.76×10^6	±4.57×10^5	±4.82×10^6	±2.23×10^4	±3.45×10^5	±2.29×10^6	±1.66×10^6	±4.39×10^6	±5.99×10^5
Procyanidins B3	3.66×10^5	1.50×10^6	3.82×10^5	4.21×10^6	5.24×10^6	2.26×10^6	4.36×10^4	6.45×10^5	1.24×10^7	9.41×10^5	1.36×10^6	5.67×10^5
	±6.44×10^4	±5.95×10^5	±1.51×10^4	±1.24×10^5	±3.01×10^5	±1.19×10^4	±5.75×10^3	±3.41×10^4	±3.09×10^5	±1.21×10^5	±3.06×10^5	±5.06×10^4
Procyanidins C1	9.16×10^4	2.21×10^5	3.82×10^3	6.53×10^5	7.09×10^5	2.65×10^5	1.11×10^4	8.81×10^4	1.22×10^7	2.52×10^5	2.80×10^5	7.52×10^4
	±2.73×10^3	±2.13×10^4	±4.09×10^2	±2.30×10^54	±1.23×10^4	±3.36×10^4	±1.33×10^3	±4.87×10^3	±2.79×10^4	±1.73×10^4	±4.09×10^4	±7.25×10^3

Dynamics of anthocyanin profiles during fruit development of four blueberry cultivars

Extensive metabolic profiling of anthocyanins during the development of Gardenblue, Legacy, Misty, and Brightwell fruits produced a total of 32 kinds of anthocyanins (Table 3), including cyanidin, delphinidin, malvidin, pelargonidin, peonidin, and petunidin. Using UPLC-ESI-MS/MS, combined with a local metabolic database, the anthocyanins that were successfully separated and identified included cyanidin 3-O-(6-O-malonyl-beta-D-glucoside), cyanidin 3-O-arabinoside, cyanidin 3-O-galactoside, cyanidin 3-O-glucoside, cyanidin 3-O-rutinoside, delphinidin 3,5-O-diglucoside, delphinidin 3-O-(6”-O-malonyl)-beta-D-glucoside, delphinidin 3-O-arabinoside, delphinidin 3-O-galactoside, delphinidin 3-O-glucoside, malvidin 3-O-arabinoside, malvidin 3-O-galactoside, malvidin 3-O-glucoside, malvidin 3-O-rutinoside, pelargonidin 3-O-(6-O-malonyl-beta-D-glucoside), pelargonidin 3-O-arabinoside, pelargonidin 3-O-galactoside, pelargonidin 3-O-glucoside, pelargonidin 3-O-rutinoside, pelargonidin 3,5-O-diglucoside, Peonidin 3,5-O-diglucoside, peonidin 3-O-(6-O-malonyl-beta-D-glucoside), peonidin 3-O-glucoside, peonidin 3-O-arabinoside, peonidin 3-O-galactoside, peonidin 3-O-rutinoside, Petunidin 3,5-diglucoside, petunidin 3-O-[6-O-malonyl-beta-D-glucoside), petunidin 3-O-arabinoside, petunidin 3-O-galactoside, petunidin 3-O-glucoside, and petunidin 3-O-rutinoside. In addition, six proanthocyanidins; procyanidin A1, procyanidin A2, procyanidin B1, procyanidin B2, procyanidin B3, and procyanidin C1 were also detected. Compared with previous studies, the structure of anthocyanins detected in this study is richer, which fully shows the diversity of anthocyanins in Guizhou blueberry. Guizhou blueberry will be a good source of anthocyanins and worthy of further study.

Table 3. The statistical of metabolites quantity

Classification	Molecular formula	Q1 (Da)	Q3 (Da)	Molecular weight	Ionization type
Cyanidin	Cyanidin 3-O-(6-O-malonyl-beta-D-glucoside)	535.1088	287.1	535.0488	[M]+
	Cyanidin 3-O-arabinoside	419.0978	287.1	419.0378	[M]+
	Cyanidin 3-O-galactoside	449.1084	287	449.0484	[M]+
	Cyanidin 3-O-glucoside	449.1084	287.1	449.0484	[M]+
	Cyanidin 3-O-rutinoside	595.1663	287.05	595.1063	[M]+
Delphinidin	Delphinidin 3,5-O-diglucoside(Delphin)	627.156125	303.2	627.096125	[M]+
	Delphinidin 3-O-(6”-O-malonyl)-beta-D-glucoside	551.1037	303.05	551.0437	[M]+
	Delphinidin 3-O-arabinoside	435.0927	303.05	435.0327	[M]+
	Delphinidin 3-O-galactoside	465.1033	303.1	465.0433	[M]+
	Delphinidin 3-O-glucoside	465.1033	303.1	465.0433	[M]+
Malvidin	Malvidin 3-O-arabinoside	463.1234913	303.2	463.0634913	[M]+
	Malvidin 3-O-galactoside	493.134601	331.06	493.074601	[M]+
	Malvidin 3-O-glucoside	493.134601	331.2	493.074601	[M]+
	Malvidin 3-O-rutinoside	639.1925	331.2	639.1325	[M]+
Pelargonidin	Pelargonidin 3-O-(6-O-malonyl-beta-D-glucoside)	519.1139	331.06	519.0539	[M]+
	Pelargonidin 3-O-arabinoside	403.1029	271.06	403.0429	[M]+
	Pelargonidin 3-O-galactoside	433.113472	271.06	433.053472	[M]+
	Pelargonidin 3-O-glucoside	433.113472	271.1	433.053472	[M]+
	Pelargonidin 3-O-rutinoside	579.1708354	271.1	579.1108354	[M]+
	Pelargonidin 3,5-O-diglucoside(Pelargonin)	595.166295	271.06	595.106295	[M]+
Peonidin	Peonidin 3,5-O-diglucoside	625.17686	271.1	625.11686	[M]+
	Peonidin 3-O-(6-O-malonyl-beta-D-glucoside)	549.12443	301.1	549.06443	[M]+
	Peonidin 3-O-glucoside	463.124	301.5	463.064	[M]+
	Peonidin 3-O-arabinoside	433.1135	301.2	433.0535	[M]+
	Peonidin 3-O-galactoside	463.124	301.1	463.064	[M]+
	Peonidin 3-O-rutinoside	609.1819	301.2	609.1219	[M]+
;Petunidin	Petunidin 3,5-diglucoside	641.171775	301.06	641.111775	[M]+
	Petunidin 3-O-(6-O-malonyl-beta-D-glucoside)	565.1188	317.066	565.0588	[M]+
	Petunidin 3-O-arabinoside	449.1084	317.06	449.0484	[M]+
	Petunidin 3-O-galactoside	479.118951	317.06	479.058951	[M]+
	Petunidin 3-O-glucoside	479.118951	317.066	479.058951	[M]+
	Petunidin 3-O-rutinoside	625.1763146	317.066	625.1163146	[M]+
others	Procyanidin A1	577.12678	317.06	576.12678	[M + H]+
	Procyanidin A2	577.12678	425.1	576.12678	[M + H]+
	Procyanidin B1	579.14243	425.1	578.14243	[M + H]+
	Procyanidin B2	579.14243	427.1	578.14243	[M + H]+
	Procyanidin B3	579.14243	427.1	578.14243	[M + H]+
	Procyanidin C1	889.43582	427.1	866.20582	[M+ Na]+
	Quercetin 3-O-glucoside	465.09548	601	464.09548	[M + H]+
	Aromadendrin (Dihydrokaempferol)	289.06339	303.1	288.06339	[M + H]+
	Dihydromyricetin	321.05322	243.1	320.05322	[M + H]+

At present, several studies have been carried out on the identification of anthocyanins in blueberries.,^[22]identified 14 anthocyanins in four blueberry cultivars using a qualitative and quantitative analysis. In the lowbush blueberry, 15 anthocyanin pigments, including delphinidin, malvidin, petunidin, peonidin, and cyanidin, were identified ^[23] In another study, a total of 17 anthocyanins, including cyanidin, delphinidin, malvidin, peonidin, and petunidin, were identified from highbush blueberries using HPLC-MS/MS analysis.^[24] The 32 kinds of anthocyanins successfully separated and identified from the four cultivars in this study add to the diversity of anthocyanins in blueberries from Guizhou.

To uncover the variability and overall trend of anthocyanin separation among the samples, PCA was performed. PCA analysis showed that the three biological repetitions of each sample clustered together, which demonstrates that our metabonomic analysis was repeatable and reliable (Figure 2). Moreover, the PCA showed that the PC1 (50.64%) values of the fruits in the same period were close, although there was great diversity in PC2 (17.3%) (Figure 2). The PC2 values of Gardenblue, Brightwell, Misty, and Legacy decreased at all three developmental stages (Figure 2). The above results indicate that the content of anthocyanin metabolites in blueberry fruit changes significantly during fruit development and that the anthocyanin profiles of Gardenblue and Legacy are similar to those of Misty and Brightwell.

Figure 2. Principal component analysis of the level of anthocyanin metabolites identified in young fruits, fruits at veraison and mature fruits of Legacy, Misty, Brightwell and Gardenblue. B1, C1, D1 and F1 represent the young fruits; B2, C2, D2 and F2 represent the fruits at veraison: B3, C3, D3 and F3 represent the mature fruits of the cultivars, respectively.

Differential analysis of anthocyanins in different growth stages of blueberry

Subsequently, the differential anthocyanin metabolites were screened according to the following criteria: fold change ≥ 2 or fold change ≤ 0.5, p ≤ .05. As shown in Figure 3, 34 significantly different anthocyanins (SDAs, including 32 upregulated and two downregulated) were identified in B1-vs-B2; 34 SDAs (32 upregulated and two downregulated) were identified in C1-vs-C2; 26 SDAs (eight upregulated and 18 downregulated) were identified in D1-vs-D2: 22 SDAs (four upregulated and 18 downregulated) were identified in F1-vs-F2. The number of upregulated anthocyanins in B1-vs-B2 and C1-vs-C2 was much higher than that of D1-vs-D2 and F1-vs-F2, while the opposite was true for the number of down-regulated anthocyanins. Thirty-one SDAs (24 upregulated and seven downregulated) were identified in B2-vs-B3; 25 SDAs (20 upregulated and five downregulated) were identified in C2-vs-C3; 32 SDAs (31 upregulated and two downregulated) were identified in D2-vs-D3: 39 SDAs (31 upregulated and eight downregulated) were identified in F2-vs-F3. Most of the anthocyanins were upregulated between the veraison and mature stages, and the number of upregulated anthocyanins in D2-vs-D3 and F2-vs-F3 was much higher than that of D1-vs-D2 and F1-vs-F2.

Figure 3. The differential anthocyanin metabolites in different group. B1, C1, D1 and F1 represent the young fruits of Legacy, Misty, Brightwell and Gardenblue, respectively; B2, C2, D2 and F2 represent the fruits at veraison; B3, C3, D3 and F3 represent the mature fruits.

At maturity, 15 upregulated and one downregulated anthocyanins were identified in B3-vs-C3; 12 upregulated and nine downregulated anthocyanins were identified in B3-vs-D3; 21 up-regulated and one downregulated anthocyanins were identified in B3-vs-F3; nine upregulated and 20 downregulated anthocyanins were identified in C3-vs-D3; 14 upregulated and seven downregulated anthocyanins were identified in C3-vs-F3: 18 upregulated and one downregulated anthocyanin were identified in D3-vs-F3 (Figure 3). The number of upregulated anthocyanins was much higher than that of the downregulated anthocyanins in B3-vs-F3, C3-vs-F3, and D3-vs-F3, indicating that the content of most of the anthocyanins in F3 was higher than that of B3, C3, and D3. This is consistent with the above results.

Analysis of differential delphinidins, malvidins, and petunidins

To demonstrate the overall trend in anthocyanins during the development of the four blueberry cultivar fruits, hierarchical clustering of all anthocyanins was performed and the distance metric for the patterns of anthocyanin levels. As shown in Figure 4a, the content of pelargonidin 3-O-(6-O-malonyl-beta-D-glucoside), petunidin 3-O-rutinoside, petunidin 3-O-arabinoside, petunidin 3-O-galactoside, petunidin 3,5-diglucoside, petunidin 3-O-(6-O-malonyl-beta-D-glucoside), petunidin 3-O-glucoside, delphinidin 3,5-O-diglucoside, delphinidin 3-O-(6”-O-malonyl)-beta-D-glucoside, delphinidin 3-O-arabinoside, delphinidin 3-O-galactoside, delphinidin 3-O-glucoside, malvidin 3-O-arabinoside, malvidin 3-O-galactoside, malvidin 3-O-glucoside, and malvidin 3-O-rutinoside in the fruits of all four cultivars increased during development. These results suggest that the three pigments (delphinidins, malvidins, and petunidins) may be the main color components of the fruits of Gardenblue, Brightwell, Misty, and Legacy. Previous studies have shown that delphinidin shows violet/blue hues, delphinidin has been found in different purple cultivars of blueberry, and color deepening was strongly associated with increased levels of delphinidin.^[25,26] Therefore, we infer that delphinidins are the main color components of the fruits of Gardenblue, Brightwell, Misty, and Legacy fruits, and malvidins and petunidins may play a secondary role in the coloring of these cultivars.

Figure 4. A. The hierarchical clustering analysis according to the level of anthocyanin metabolites identified in young fruits, fruits at veraison and mature fruits of Legacy, Misty, Brightwell and Gardenblue. B. The hierarchical clustering analysis according to the level of delphinidins, malvidins and petunidins in mature fruits of Legacy, Misty, Brightwell and Gardenblue. B1, C1, D1 and F1 represent the young fruits; B2, C2, D2 and F2 represent the fruits at veraison: B3, C3, D3 and F3 represent the mature fruits of cultivars, respectively.

Furthermore, the hierarchical clustering of all delphinidins, malvidins, and petunidins showed that the levels of malvidin 3-O-galactoside, malvidin 3-O-glucoside, malvidin 3-O-rutinoside, delphinidin 3-O-glucoside, delphinidin 3,5-O-diglucoside(delphin), petunidin 3-O-glucoside, and petunidin 3-O-rutinoside were higher in the mature fruits of Gardenblue than those in Brightwell, Misty, and Legacy (Figure 4b). The highest level of delphinidin 3-O-(6”-O-malonyl)-beta-D-glucoside, petunidin 3-O-(6-O-malonyl-beta-D-glucoside), petunidin 3-O-arabinoside, delphinidin 3-O-arabinoside, and delphinidin 3-O-galactoside was found in the mature fruits of Misty (Figure 4b). Brightwell had higher levels of petunidin 3,5-diglucoside and petunidin 3-O-galactoside in its mature fruits than those found in the other three cultivars (Figure 4b).

Expression of genes related to anthocyanins biosynthesis in different growth stages of blueberry

The expression of several genes related to the anthocyanin biosynthetic pathway,^[27] including the genes encoding dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS), flavanone 3-hydroxylase (F3H), flavonoid 3’ hydroxylase (F3ʹH), flavonoid 3ʹ5’ hydroxylase (F3ʹ5’H), UDPG-flavonoid glucosyl transferase (UFGT), and flavonol synthase (FLS), was analyzed by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) at different developmental stages of Gardenblue, Brightwell, Misty, and Legacy fruits.

As shown in Figure 5, the expression level of ANS gradually increased in the fruits of all four cultivars during development. Moreover, the expression level of ANS in mature fruits of Gardenblue was higher than that in Brightwell, Misty, and Legacy (Figure 5). The transcriptional level of F3H also gradually increased in the fruits of all four cultivars during development (Figure 5). The transcriptional level of ANS in mature fruits of Misty was higher than that in Brightwell, Gardenblue, and Legacy (Figure 5). Overall, the transcriptional levels of F3ʹ5’H, DFR, F3ʹH, and UFGT in fruits of Gardenblue were higher than those in Brightwell, Misty, and Legacy during development (Figure 5). In addition, the transcriptional level of FLS, responsible for the synthesis of flavonol, was higher in fruits of Brightwell than in Gardenblue, Misty, and Legacy during development (Figure 5). Since F3ʹH and F3ʹ5’H are the primary enzymes responsible for the diversification of anthocyanins,^[28] the preferential expression of ANS, F3ʹ5’H, and UFGT was largely responsible for the high levels of delphinidin 3-O-glucoside and delphinidin 3,5-O-diglucoside(delphin) in fruits of Gardenblue. Moreover, the high expression levels of DFR, F3ʹ5’H, F3ʹH, and UFGT may be the main reason for the higher level of malvidin 3-O-galactoside, malvidin 3-O-glucoside, malvidin 3-O-rutinoside, petunidin 3-O-glucoside, and petunidin 3-O-rutinoside in Gardenblue fruit. This is a major finding of our study.

Figure 5. Quantitative RT-PCR analysis of the expressions of F3H, FLS, ANS, DFR, F3ʹ5’H, F3ʹH and UFGT in different development stages of Gardenblue, Brightwell, Misty and Legacy fruits. The relative quantity of the gene transcriptional level was determined according to the internal control (SAND). Three biological replicates were performed. Means ± SE are shown. Gene names are abbreviated as follows: dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS), flavanone 3-hydroxylase (F3H), flavonoid 3’ hydroxylase (F3ʹH), flavonoid 3ʹ5’ hydroxylase (F3ʹ5’H), UDPG-flavonoid glucosyl transferase (UFGT), flavonol synthase (FLS).

Conclusion

To summarize, the anthocyanin profiles of the fruits of four blueberry cultivars (Gardenblue, Legacy, Misty, and Brightwell) were systematically investigated at different developmental stages. Based on metabonomics, a total of 32 kinds of anthocyanins were quantified using UPLC-ESI-MS/MS. The anthocyanin content increased significantly in all four cultivars during development from immature to mature fruits. Gardenblue, which had the darkest color, also had the highest anthocyanin content. Delphinidins were the main color substance found in the fruit of all the cultivars, whereas malvidins and petunidins may play important secondary roles in the color process. Based on qRT-PCR analysis of several genes related to the anthocyanin biosynthetic pathway, F3ʹH and F3ʹ5’H are the primary enzymes responsible for the diversification of anthocyanins. The preferential expression of ANS, F3ʹ5’H, and UFGT was largely responsible for the high levels of delphinidin 3-O-glucoside and delphinidin 3,5-O-diglucoside (delphin) in the fruits of Gardenblue. Moreover, the higher expression of DFR, F3ʹ5’H, F3ʹH, and UFGT may be the main reason for the higher level of malvidin 3-O-galactoside, malvidin 3-O-glucoside, malvidin 3-O-rutinoside, petunidin 3-O-glucoside, and petunidin 3-O-rutinoside in the fruits of Gardenblue. Manipulation of these structural genes may be a mechanism to improve the sensory quality of blueberries through the selective expression of color by controlling the accumulation of anthocyanins.

Highlights

• Anthocyanin profiles of fruits of four blueberry cultivars were investigated

• Thirty three kinds of anthocyanins were quantified using UPLC-ESI-MS/MS

• F3’H and F3’5’H are the primary enzymes responsible for anthocyanin diversification

• ANS, F3’5’H, and UFGT preferential expression may lead to higher levels of pigments

• Anthocyanins and sensory quality may be improved in blueberry by gene modification

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This work was supported by the Department of Education of Guizhou Province Youth Plan [Qian Jiao KY-[2019] No. 093]; Guiyang science and technology plan project (Zhuke contract (2021) No. 43-17).