Analysis of global DNA methylation and epigenetic modifiers (DNMTs and HDACs) in human foetal endothelium exposed to gestational and type 2 diabetes

ABSTRACT

Foetuses exposed to maternal gestational diabetes (GDM) and type 2 diabetes (T2D) have an increased risk of adverse perinatal outcomes. Epigenetic mechanisms, including DNA methylation and histone modifications, may act as mediators of persistent metabolic memory in endothelial cells (ECs) exposed to hyperglycaemia, even after glucose normalization. Therefore, we investigated alterations in global DNA methylation and epigenetic modifier expression (DNMT1, DNMT3a, DNMT3b, HDAC1, and HDAC2) in human umbilical vein ECs (HUVECs) from the umbilical cords of mothers with GDM (n = 8) and T2D (n = 3) compared to that of healthy mothers (n = 6). Global DNA alteration was measured using a 5-methylation cytosine colorimetric assay, followed by quantitative real-time polymerase chain reaction to measure DNA methyltransferase and histone acetylase transcript expression. We revealed that DNA hypermethylation occurs in both GDM- and T2D-HUVECs compared to that in Control-HUVECs. Furthermore, there was a significant increase in HDAC2 mRNA levels in GDM-HUVECs and increase in DNMT3b mRNA levels in T2D-HUVECs. Overall, our results suggest that GDM and T2D are associated with global DNA hypermethylation in foetal endothelial cells under normoglycemic conditions and the aberrant mRNA expression of HDAC2 and DNMT3b could play a role in this dysregulation.

Key policy highlights

• Global DNA hypermethylation was reported in foetal endothelial cells of both gestational and type 2 diabetes cultured under normal glucose condition

• HDAC2 mRNA was significantly increased in gestational diabetes

• DNMT3b mRNA was significantly increased in type 2 diabetes

• Our data support the concept of epigenetic programming occurs in foetal endothelial cells exposed to diabetes which retain even after glucose normalization

KEYWORDS:

• Endothelial cells
• gestational diabetes
• type 2 diabetes
• DNA methylation
• epigenetic enzymes

Introduction

Type 2 diabetes (T2D) is a multifactorial disorder characterized by impaired carbohydrate metabolism and hyperglycaemia [1]. Saudi Arabia has the second highest prevalence of diabetes among Middle Eastern countries and ranks seventh in the world [2]. The prevalence of Saudi Arabian women with either pre-existing T2D or gestational diabetes mellitus (GDM) is approximately 40% [3]. Such increased percentages suggest that further research should be conducted to understand the pathological effects of diabetes in both mothers and foetuses. T2D affects 90% of patients with diabetes mellitus and is caused by resistance to insulin, which is also accompanied by a deficiency in insulin secretion. GDM is defined as the first diagnosis of glucose intolerance during pregnancy. GDM is associated with long-term complications in the mother and foetus and is characterized by hyperglycaemia due to insulin insensitivity, which usually reverts to normal after delivery. However, some mothers with GDM develop T2D after delivery for unknown reasons. The prevalence of GDM in pregnant Saudi Arabian women is the highest in the world and can increase maternal and foetal morbidities and mortalities [4]. Untreated GDM is associated with a wide-spectrum of foetal complications, starting with being overweight at birth, cardiac dysfunction, and malformations [5]. Numerous studies have verified the association between intrauterine exposure to hyperglycaemia and an increased risk of obesity, diabetes, and cardio-metabolic disorders in offspring, suggesting that epigenetic modifications may be the primary cause of metabolic memory [6–10]. El-Osta et al. [11,12] reported that transient exposure of cultured human and bovine aortic endothelial cells to elevated glucose concentration (30 mM) induced persistent epigenetic changes in the promoter region of the nuclear factor (NF)-κB p65 subunit and altered gene expression of molecules including vascular cell adhesion molecule 1 and monocyte chemotactic protein 1 during subsequent normoglycemia.

Epigenetic changes involve DNA methylation and histone modifications. Histone acetyltransferases mediate histone acetylation, which opens the DNA double helix and allows free access for gene transcription. Conversely, histone deacetylases cause hypoacetylation of histones, which condenses chromatin structure and represses gene transcription [13]. A family of enzymes responsible for histone modification (e.g., acetylation or deacetylation) includes histone methyltransferases, histone acetyltransferases, and demethylases [14]. Under hyperglycaemic conditions, specific histone methylation occurs in endothelial cells and is associated with a chronic inflammatory phenotype [11,15].

Few studies have addressed the importance of DNA methylation in the pathogenesis of diabetes and its associated complications [16–18]. DNA methylation is regulated by three DNA methyltransferase (DNMTs) enzymes, DNMT1, DNMT2, and DNMT3 (subunits a and b). Both specific and global DNA methylation are believed to contribute to endothelial dysfunction caused by complications of diabetes [19,20]. Both hypermethylation and hypomethylation have been reported in diabetes, suggesting their possible involvement in disease onset and progression by regulation of gene expression related to diabetes. Interestingly, insulin gene expression is also regulated by DNA methylation [21]. In addition, increased global DNA methylation has been reported in the placenta of patients with GDM [22]. Zhu et al. [23] identified 361 hypomethylation-high and 541 hypermethylation-low genes in GDM. Moreover, DNA hypomethylation at the Long Interspersed Nuclear Element 1 (LINE-1) sequences, may contribute to cardiovascular and metabolic complications in T2D [24]. However, it remains to be fully elucidated whether alterations in global DNA methylation and epigenetic enzymes occur in the foetal endothelium in GDM or T2D under normal glucose conditions. Therefore, this study aimed to determine whether GDM and T2D are associated with global DNA methylation changes and alterations in the transcript expression of five epigenetic modifiers (DNMT1, DNMT3a, DNMT3b, HDAC1, and HDAC2) in foetal endothelial cells under normoglycemic conditions.

Materials and methods

All reagents were purchased from UFC biotechnology (Buffalo, NY, USA) unless otherwise stated.

Participants and HUVECs isolation

Umbilical cords were collected from women after full-term pregnancy at the East Jeddah General Hospital, Saudi Arabia. All participants were notified of the aims of the study, and written informed consent was obtained before the collection of umbilical cords. Approval for the study was obtained from the Ethics Committee at the Research and Studies Department, Directorate of Health Affairs, Jeddah (IRB registration number H-02-J-002; approved on 29 January 2020). Samples were collected on the day of delivery. Control subjects who were on medication, or had a family history of diabetes, high blood pressure, and/or smoking were excluded from the study. Participants with a fasting plasma glucose concentration of >7 mmol/L or HbA1c > 7% were considered to have T2D according to the American Diabetes Association [25]. Subjects with GDM had a positive oral glucose tolerance test according to the WHO criteria [26]. All patients with GDM were on a diet whereas patients with T2D were on insulin therapy. None of the patients experienced any other obstetric complications such as pre-eclampsia. HUVECs were isolated from participants with GDM (n = 8), T2D (n = 3), and healthy mothers (n = 6) using the collagenase method [27]. Subsequently, HUVECs were cultured in M199 medium supplemented with 20% foetal bovine serum, 100 U penicillin/100 mg/mL streptomycin, 2.5 μg/mL fungizone, and 2 mM L-glutamine at 37°C under 95% air and 5% CO₂ humidified conditions. The cells were used for up to four passages. Characterization of cultured HUVECs with CD31 was performed as described previously [28].

DNA extraction

DNA extraction was performed using the QIAamp DNA Mini Kit (Qiagen, Manchester, UK) following the manufacturer’s protocols. DNA concentration was quantified using a Nanodrop 2000 spectrophotometer (Agilent, Edinburgh, UK).

Global DNA methylation

Global methylated DNA quantification (colorimetric) 5-methylation cytosine (5-mC) analysis was performed using a 5-mc colorimetric assay (Abcam, Cambridge, UK) following the manufacturer’s instructions. Briefly, 100 ng of relatively pure DNA with a 260/280 ratio of 1.8 were treated with the binding solution and incubated at 37°C for 60 min. The plate was washed with a buffer. DNA samples were incubated with anti-5-mC monoclonal and detection antibodies. After the addition of the enhancer and developer solutions, the absorbance was read at 450 nm using a microplate spectrophotometer system.

RNA extraction and cDNA conversion

Total RNA was extracted from HUVECs using an RNeasy Mini Kit (Qiagen). RNA quantity was checked using a spectrophotometer and quality was assessed using an Agilent 2100 Bioanalyzer (Agilent). DNase I digestion was performed during RNA isolation to exclude contamination with genomic DNA. cDNA was synthesized from 1 µg of total RNA using the ImProm-II™ Reverse Transcription System (Promega, Madison, WI, USA), according to the manufacturer’s protocols.

Quantitative real-time polymerase chain reaction (Qrt-PCR)

Primers were designed using Primer3web version 4.1.0 and the sequences are listed in Table 1. Beta-actin was used as the endogenous reference gene to normalize the results. Amplifications were performed using the QuantiTect SYBR Green PCR Kit (Qiagen) in the iCycleriQ RT-PCR System (Applied Biosystems, Cheshire, UK) following the manufacturer’s instructions. Relative gene expression was quantified using Rest 2009 software version 2.0.13 [29].

Table 1. The primers used in RT-PCR.

Name of the primer	Sequence 5’-3’
DNMT1_F	AGGGCTACCTGGCTAAAGTC
DNMT1_R	CCTCTCCATCGGACTTGCTC
DNMT3a_F	CGAGAGCAGAGGACGAGCC
DNMT3a_R	GTGTTGAGCCCTCTGGTGAA
DNMT3b_F	TGGAGCCACGACGTAACAAA
DNMT3b_R	GCATCCGTCATCTTTCAGCCTA
HDAC1_F	ATGCAAAGAAGTCCGAGGCA
HDAC1_R	ACCCTCTGGTGATACTTTAGCA
HDAC2_F	GGGAATACTTTCCTGGCACA
HDAC2_R	ACGGATTGTGTAGCCACCTC
Beta-actin_F	AGCCTCGCCTTTGCCGA
Beta-actin_R	CTGGTGCCTGGGGCG

Statistical analysis

Normality distribution was checked using the Shapiro-Wilk test. Data are expressed as the mean ± standard error of mean. Student’s t-tests were performed to compare the differences between the groups using GraphPad Prism (version 8.0.0; GraphPad Software Inc., San Diego, CA, USA). P < 0.05 was considered to indicate statistically-significant differences.

Results

The clinical parameters of the donors recruited in this study are summarized in Table 2. Random plasma glucose (RPG) levels were significantly higher in the GDM group than in the control group (P = 0.01). However, the T2D group had higher haemoglobin A1c (HbA1c)% levels than the healthy control group (P = 0.004). There were no significant differences in other parameters between the two groups.

Table 2. List of Mean characteristics of subjects participating in the study.

Status mothers	Controls (n = 6)	GDM (n = 8)	T2D (n = 3)	P (GDM vs controls)/(T2D vs controls)
Age (years	29 ± 1.8	33 ± 5	31 ± 8	0.07/0.17
BMI	26.9 ± 1.8	33 ± 2	25.9 ± 0.6	0.06/0.2
HbA1c %	4.9 ± 0.4 (n = 3)	6.5 ± 0.3 (n = 6)	8.9 ± 0.5	0.05/0.004
RPG (mM)	4.9 ± 0.4	7.2 ± 0.7	13 ± 3	0.01/0.05
Height (cm)	160 ± 0.02	155 ± 0.02	159 ± 0.6	0.05/0.6
Weight (kg)	70 ± 5.6	80 ± 5.9	65 ± 4	0.1/0.3

#at 12 weeks pregnancy; RPG, Random plasma glucose; BMI, body mass index, HbA1c, glycosylated haemoglobin; GDM, gestational diabetes mellitus, mean ± SEM. Number of donors donated by (n).

Results of DNA methylation

In the present study, DNA isolated from GDM-HUVECs exhibited a significant increase in the 5-mC% status (P = 0.002) compared to that in the Control-HUVECs, as shown in Figure 1. Additionally, there was a near significant (P = 0.05) increase in global DNA methylation in T2D-HUVECs compared to that in Control-HUVECs.

Figure 1. Percentage of global DNA methylation in Control-HUVECs vs GDM-HUVECs and T2D-HUVECs. ELISA was performed to determine 5mC levels. **P < 0.01 vs controls. HUVEC, human umbilical vein endothelial cells; GDM, gestational diabetes mellitus; T2D, Type 2 diabetes; C, control.

Gene expression analysis using Qrt-PCR

An approximately 431-fold increase in the mRNA level of HDAC2 was observed in GDM-HUVECs compared to in Control-HUVECs (P = 0.019), as shown in Figure 2. Although we noticed an increase in DNMT3b expression in GDM-HUVECs when compared to that in Control-HUVECs, it was not statistically significant (P > 0.05). In addition, there was an increase in the mRNA levels of DNMT3b in T2D-HUVECs compared to that in Control-HUVECs (P = 0.002, Figure 3).

Figure 2. Expression levels of the epigenetic markers (a) DNMTs and (b) HDACs in GDM-HUVECs (n = 8) and Control-HUVECs (n = 6) were measured using Qrt-PCR. Gene expression was normalized to the mRNA level of the housekeeping gene β-actin in each sample. Results are expressed as the mean ± SEM. **P < 0.5 versus controls.

Figure 3. Expression levels of the epigenetic markers (a) DNMTs and (b) HDACs in T2D-HUVECs (n = 3) and Control-HUVECs (n = 6), were measured using Qrt-PCR. Gene expression was normalized to the mRNA level of the housekeeping gene β-actin in each sample. Results are expressed as the mean ± SEM. **P < 0.01 versus controls.

Discussion

In the present study, an in vitro model was employed to provide some evidence that both GDM and T2D are associated with global changes in DNA methylation in HUVECs cultured under normal glucose conditions. In addition, both GDM and T2D were found to affect epigenetic enzyme modifiers, as higher mRNA levels of HDAC2 and DNMT2 were observed in GDM-HUVECs and T2D-HUVECs, respectively. These findings support the concept of glycaemic memory, wherein the damaging effect of hyperglycaemia can induce epigenetic changes even after the normalization of glucose levels. Previous studies have verified the relationship between diabetes and epigenetic changes in HUVECs [30–32]. Moreover, several studies have noted DNA methylation as the main cause of glycaemic memory that leads to diabetic end-organ complications, such as diabetic nephropathy and retinopathy [33–40]. Epigenetic changes include DNA methylation, histone modifications, and microRNA gene dysregulation. The most common epigenetic modification occurs because of methylation of cytosine at enriched gene promoters and 5’ regions of CpG dinucleotide sites [41]. Accordingly, hypomethylation of promoters generally facilitates gene transcription, whereas hypermethylation is associated with gene silencing [42].

Consistent with our present findings, a previous study showed that overall hypermethylation increased the expression of genes related to glycolipid metabolism and related signalling pathways, including Agap2, in the pancreas of offspring of GDM mice [43]. Another study showed that progressive epigenetic silencing via DNA methylation of the Pdx1 promoter – a transcription factor that affects beta cell differentiation – promotes the development of diabetes [44]. Interestingly, Pepin et al. [45] found that transient exposure to a high concentration of glucose (75, 175, and 200 mg/dL) for 72 h induces epigenetic changes and DNA methylation in genes involved in endothelial dysfunction, including vascular endothelial growth factor, and nitric oxide production in aortic endothelial cells. In contrast to our model, Howe et al. [46] found that maternal GDM is associated with DNA hypomethylation in cord blood. This may be explained by the fact that different tissues display different forms of methylation.

DNMT3a and DNMT3b are members of a family of DNA methyltransferases that can methylate hemimethylated and un-methylated CpG at the same rate [47,48]. The architecture of DNMT3 is similar to that of DNMT1, with a regulatory region attached to the catalytic domain. Interestingly, overexpression of DNMT3b plays an essential role in the development of endothelial cell dysfunction through increased DNA hypermethylation and subsequent suppression of the anti-atherosclerosis cellular repressor of E1A-stimulated genes [49]. The mechanism underlying increased DNMT3b expression in T2D-HUVECs is currently unknown; however, we speculate it to be induced by oxidative stress. Hyperglycaemia increases an inflammatory marker nitric oxide synthase that induces increased oxidative stress and endothelial dysfunction in mothers as well as their foetuses [50]. Increased oxidative stress has been previously reported in HUVECs isolated from patients with GDM [51] and T2D [52]. Interestingly, oxidative stress has been identified as the main cause of epigenetic changes in methylation enzymes in diabetes [53]. This suggests that increased oxidative stress in T2D could facilitate activation of DNMT3b, which could eventually lead to the observed hypermethylation. Consistently, previous studies showed that overexpression of DNMT induces CpG hypermethylation in cultured cell lines [54,55].

HDAC1 and HDAC2 promote the regulation of the chromatin structure. HDAC1 is involved in endothelial dysfunction by reducing nitric oxide levels in endothelial cells [56,57]. Our study provides quantitative data on the increase in mRNA expression of the epigenetic modifier enzyme HDAC2 in GDM-HUVECs. This is supported by a study that showed that exposure to elevated glucose (25 mM) for 24 h enhanced the protein expression of the epigenetic marker HDAC2 in cardiomyocytes [58]. Moreover, two genome-wide association studies have shown a linkage between the chromosomal region (6q21) of HDAC2 and type 1 and T2D, indicating its possible pathogenic role [59,60]. Furthermore, several studies have highlighted the effects of HDAC2 on endothelial cell dysfunction in offspring of cardiovascular diseases [61]. Hyperglycaemia induces HDAC2 to promote endothelial dysfunction [62,63]. As shown in Table 2, increased glucose concentrations were observed in participants with GDM and T2D, indicating the pivotal role of glucose in the observed changes in isolated HUVECs. Although, we noted increased body mass index in the GDM group; however, this was not significant when compared to the healthy controls, and hence its effect was ruled out (Table 2).

The main limitation of the present study is the small sample size; however, the significant values obtained strongly confirm the validity of the findings. Large-scale studies are required to further verify the findings of this study. In addition, colorimetric assays do not provide information with regards which genes are hypomethylated or hypermethylated. Although we did not measure protein levels of epigenetic enzymes, a previous study using a different model showed that the mRNA expression of epigenetic enzymes correlated with their protein levels [64].

We recommend extending this study to test various enzymes related to metabolic syndrome, endothelial dysfunction, and oxidative stress. It would also be interesting to assess hydroxy-methylation and TET enzyme levels in the future. Such a study would provide broader insight into epigenetic foetal programming caused by diabetes.

Overall, our results suggest that the aberrant expression of epigenetic modifiers HDAC2 and DNMT3b in foetal endothelial cells exposed to GDM and T2D, respectively could be involved in the observed dysregulation of global DNA methylation under normoglycemic condition. These findings support the growing notion that foetal exposure to GDM and T2D may induce persistent epigenetic changes in endothelial cells.

Acknowledgments

We are grateful to all the participants of the study and the nursing staff who helped in the sample collection.

Disclosure statement

No potential conflict of interest was reported by the authors.

Data availability statement

No large sets of sequencing or proteomic data were generated. All the data that support the findings of this study are included in the manuscript.

Additional information

Funding

This work was supported by the Deanship of Scientific Research (DSR) at King Abdulaziz University under Grant [number G: 629-290-1441].