Authentication of the Apis cerana honey with the proofreading enzyme-mediated probe cleavage combined with ladder-shape melting temperature isothermal amplification (Proofman-LMTIA) method

Figures & data

Figure 1. Melting-temperature curve of the target sequence of A. cerana.

Table 1. Primers and probe sequences of the Proofman-LMTIA method.

Primer/probe name	Sequence(5´-3´)
F	AGGCCTGATCCAAATTTTCACACATTGCGATCTATGGATATAAT
B	TTTGGATCAGGCCTTTTTGCGCAATGCAAGTATTTAGGT
LB	GGCTGAGGGTCGTTC
Proofman Probe	5’BHQ1-GGCTGAGGGTCGTTA-3′JOE

Figure 2. Temperature optimization of the Proofman-LMTIA reaction: 60 °C (A); 61 °C (B); 62 °C (C); 63 °C (D).

Figure 3. Specificity determination of the Proofman-LMTIA method.

Figure 4. Sensitivity determination of the Proofman-LMTIA method.

Figure 5. Scatter plot of the sensitivity determination with the droplet digital PCR method.

Table 2. Copy number and total drop number determined with the droplet digital PCR method.

Statistical list	A	B	C	D	E	F
Sample	Negative template	50 ng	10 ng	1 ng	100 pg	10 pg
Copy number	0	27,468	2816.2	262.3	27.2	0
Total number of drops	28,710	47,411	45,708	47,787	42,783	44,389

Table 3. Results of A. cerana honey samples determined with the Proofman-LMTIA.

Samples	Test results	Samples	Test results
Negative control (ddH2O)	−	Kunming, Yunnan Province, China	−
Positive control (A. cerana DNA)	+	Jincheng, Shanxi Province, China	+
Xuchang, Henan Province, China	−	Jinhua, Zhejiang Province, China	−
Kunming, Yunnan Province, China	−	Luoyang, Henan Province, China	−
Luoyang, Henan Province, China	−	Xuchang, Henan Province, China	−
Aksu, Xinjiang Uygur Autonomous Region, China	+	Aksu, Xinjiang Uygur Autonomous Region, China	+
Jinhua, Zhejiang Province, China	−	Kunming, Yunnan Province, China	−

Data availability statement

The data that support this study are available from the corresponding author upon reasonable request.