DNA barcoding approach to characterize microalgae isolated from freshwater systems in Ecuador

Figures & data

Table 1. Primer combinations, the annealing temperature (Ta) and expected amplicon size (bp) for each set of primers used in this study

Gene name	Primer ID: sequence (5’-3’)	Ta	Amplicon size (bp)	Reference
16S rDNA	CYA106F: CGGACGGGTGAGTAACGCGTGA CYA781R: GACTACTGGGGTATCTAATCCCATT	55°C	675	[90]
ITS	ITSCYA236F: CTGGTTCRAGTCCAGGAT ITSCYA225R: TGCAGTTKTCAAGGTTCT	52°C	Variable 180 to 900	[78]
18S rDNA V4	DIV4for: GCGGTAATTCCAGCTCCAATAG DIV4rev3: CTCTGACAATGGAATACGAATA	48°C	329	[91]
18S rDNA V1-V3	A: AACCTGGTTGATCCTGCCAG SSU-inR: CACCAGACTTGCCCTCCA	55°C	563	[63]
rbcL	rbcL_192: GGTACTTGGACAACWGTWTGGAC rbcL_657: GAAACGGTCTCKCCARCGCAT	48°-52°C	465	[38]
	rbcL_375: TTTGGTTTCAAAGCIYTWCGTGC rbcL_1089: ATACCACGRCTACGRTCTTT		714

Table 2. Molecular Operational Unit Taxonomic (MOTU) identified for Chlorophyta, indicating the number, location of isolates (Table S1), and GenBank accession numbers (AN)

Strain	No. of isolates	Location	18S AN	rbcL AN
M-01	14	Colta, Ilincocha, Loreto, Manantial, Mica, Mojanda, Rodeococha lagoon	MT497360	MT550632
M-02	20	Colta, Chinchilla, Ilincocha, Limoncocha, Manantial, Pisayambo lagoon; Yambo lake; Quito pond; Papallacta reservoir	MT497361	-
M-03	1	Quito pond	MT497362	MT550633
M-04	5	Manantial lagoon; Sumaco Napo Galeras National Park pond; Pita river	MT497363	MT550634
M-05	1	Chinchilla lagoon	MT497364	MT550636
M-06	1	Pita river	MT497365	MT550637
M-07	22	Anteojos, Chinchilla, Manantial, Mica, Mojanda, Rodeococha, Toreadora lagoon; Quito pond, Pita river	MT497366	MT550638
M-08	6	Anteojos, Colta, Manantial, Mica lagoon; Pita river	MT497367	MT550639
M-09	1	Quito pond	MT497368	MT550640
M-10	1	Rodeococha lagoon	MT497369	MT550641
M-11	1	Yasuní National Park pond	MT497370	MT550642
M-12	1	San Pedro river	MT497371	-
M-13	1	Manduriacu Reservoir	MT497372	MT550643
M-14	1	Negra lagoon; San Pablo lake	MT497373	MT550644
M-15	1	Pisayambo lagoon	MT497375	-
M-16	1	Pintag pond	MT497376	-
M-17	1	Negra lagoon	MT497378	MT550645
M-18	1	Kuyuk lagoon	MT497377	MT550646
M-19	1	Sumaco Napo Galeras National Park pond	MT497379	MT550647
M-20	1	Sumaco Napo Galeras National Park pond	MT497380	MT550635

Table 3. MOTU identified for Cyanobacteria, indicating the number, location of isolates (Table S1), and GenBank accession numbers (AN)

Strain	No. of isolates	Location	16S AN	ITS AN
C-01	2	Loreto, Mojanda lagoon	MT497339	MT497359
C-02	1	Quito pond	MT497341	MT497358
C-03	1	Chimborazo Wildlife Reserve stream	MT497340	MT497350
C-04	1	Pintag pond	MT497343	MT497355
C-05	1	Negra lagoon	MT497344	MT497356
C-06	1	Limoncocha lagoon	MT497345	-
C-07	1	Chimborazo Wildlife Reserve stream	MT497346	MT497354
C-08	1	Mojanda lagoon	MT497347	MT497353
C-09	1	Mojanda lagoon	MT497348	MT497352
C-10	1	Manduriacu reservoir	MT497349	MT497351

Table 4. Molecular identification of the Chlorophyta strains used in this study, including the percentage of identity, accession number, and the name of the identified species in the GenBank database, based on the 18S V4 and rbcL marker sequence. * indicates query cover below 100%

Strain	18SV4	% Id	No. of Hits	Closest match	rbcL	% Id	No. of Hits	Closest match
M-01	Scenedesmus sp.	100	16	MN630585.1	Tetradesmus dimorphus	99	2	KT777984.1
	Tetradesmus obliquus	100	15	KY637056.1
	Acutodesmus bajacalifornicus	100	9	KY587455.1
	Acutodesmus deserticola	100	4	MG597607.1
	Tetradesmus dimorphus	100	2	MK764915.1
M-02	Coelastrella sp.	100	23	MH176102.1	Not amplified
	Scenedesmus sp.	100	9	HE717102.1
	Pseudospongiococcum sp.	100	5	KU057947.1
M-03	Desmodemus subspicatus	100	5	KU666441.1	Acutodesmus deserticola	98	7	KT777986.1
	Scenedesmus armatus	100	3	KX494985.1
	Acutodesmus deserticola	100	2	KX494991.1
	Coelastrum sp.	100	1	KT279475.1
M-04	Desmodesmus abundans	100	3	MH307943.1	Desmodesmus pannonicus	95	1	MK257140.1
	Scenedesmus abundans	100	1	KT868823.1	Scenedesmus obliquus	94	1	GU192437.1
M-05	Desmodemus sp.	99 *	2	AB917137.1	Desmodesmus sp.	93	1	KF975599.1
	Scenedesmaceae sp.	96	1	AY197639.1
M-06	Micractinium inermum	100	5	AB731604	Chlorella sp.	98	1	MK295222
	Chlorella sorokiniana	99	30	MH879792.1	Micractinium pusillum	97	1	EF113451.1
	Chlorella vulgaris	99	12
M-07	Chlorella sorokiniana	100	36	MN365023.1	Chlorella sorokiniana	99	3	MK842150.1
	Chlorella vulgaris	100	21	KU720636.1
	Micractinium pusillum	100	2	MG597609.1
M-08	Chlorella vulgaris	100	69	MT137382.1	Chlorella vulgaris	100	7	MK948102.1
M-09	Parachlorella kessleri	100	27	KX021356.1	Parachlorella kessleri	100	4	FJ968741.1
	Dictyosphaerium sp.	100	10	GQ487245.1	Chloroidium saccharophilum	100	4	MK295212.1
	Masaia oloidia	100	5	MN626411.1
	Chloroidium saccharophilum	100	3	KX495039
M-10	Gloeotilopsis sterilis	99	2	KM020063.1	Geminella sp.	99	1	EF113442.1
					Gloeotilopsis sterilis	98	1	KM462877.1
M-11	Stichococcus cf. deasonii	100	2	KF144233.1	Stichococcus sp.	94	1	EF589147
M-12	Stigeoclonium helveticum	100	4	EU123941.1	Not amplified
	Stigeoclonium tenue	100	2	MN209224.1
M-13	Chlorolobion braunii	100	4	MK920311.1	Chlorolobion braunii	99	3	KT355757.1
	Monoraphidium sp.	100	2	KF805717.1
M-14	Caespitella pascheri	100	2	LN870281.1	Fritschiella sp.	92	1	EF113437.1
M-15	Trebouxiaceae sp.	98	20	MG493307	Not amplified
	Heterochlorella luteoviridis	98	2	KM116462.1
	Jaagichlorella africana	98	2	MH780938.1
M-16	Haematococcus lacustris	100	19	MF992170.1	Not amplified
M-17	Neochlorosarcina sempervirens	100	3	KR607495.1	Neochlorosarcina sempervirens	97	1	MK257153.1
M-18	Chlorococcum sp.	100	5	MT026583.1	Chlorococcum sp.	97	2	KC810302.1
	Oophila amblystomatis	100	1	KY091671.1	Oophila sp.	95	1	KJ635644.1
M-19	Ankistrodesmus fusiformis	99	3	KF673388.1	Ankistrodesmus fusiformis	94	1	EF113406.1
M-20	Desmodesmus sp.	99	13	MH307951.1	Desmodesmus sp.	97	1	KF975595.1

Figure 1. Phylogram constructed using 18SV4 rDNA sequences from Ecuadorian strains and sequences in the GenBank database belonging to the Chlorophyceae class. The phylogram was constructed using the maximum-likelihood method with a Kimura 2-parameter model using a discrete Gamma distribution (+G). Numerical values at the nodes of the branches indicate bootstrap values above 50%

Figure 2. Phylogram constructed using 18SV4 rDNA joined to rbcL sequences of the Ecuadorian MOTUs. The phylogram was constructed using the maximum-likelihood method with a Kimura 2-parameter model. Numerical values at the nodes of the branches indicate bootstrap values above 50%

Figure 3. Phylogram constructed using 18SV4 rDNA sequences from Ecuadorian strains and similar sequences in the GenBank database belonging to the Trebouxiophyceae class. The phylogram was constructed using the maximum-likelihood method with the Kimura 2-parameter model using a discrete Gamma distribution (+G). Numerical values at the nodes of the branches indicate bootstrap values above 50%

Table 5. Molecular identification of the Cyanobacteria strains used in this study, including the percentage of identity, accession number, and the name of the identified species in the GenBank database, based on the 16S and ITS marker sequence. * indicates query cover below 100%

MOTU	16S	% Id	No. of Hits	Closest match	ITS	% Id	No. of Hits	Closest match
C-01	Synechocystis sp.	100	35	AY224195.1	Synechocystis sp.	97	30	MH683823.1
	Aphanocapsa sp.	100	2	JQ070058.1
C-02	Chroococcidiopsis thermalis	100	11	NR102464.1	Chroococcidiopsis thermalis	100	5	CP003597.1
C-03	Unidentified cyanobacterium	99	7	HQ827392.1	Pseudanabaena sp.	93	1	LT600730.1
C-04	Nostoc sp.	99	2	MK953016.1	Nostoc sp.	92*	1	MK953016.1
C-05	Unidentified cyanobacterium	99	16	KP143908.1	Synechococcus sp.	95*	5	AJ519834.1
C-06	Cylindrospermopsis raciborskii	98	99	EU078548.1	No determined
C-07	Pseudanabaena sp.	99	4	MN145867.1	Pseudanabaena sp.	93	3	LC314140.1
C-08	Leptolyngbya sp.	99	2	KX495135	Leptolyngbyaceae	97*	2	MK861878
C-09	Pseudanabaena sp.	99	2	KR872397.1	Pseudanabaena sp.	90*	7	LC314124.1
C-10	Limnothrix planktonica	100	13	JQ004021.1	Limnothrix sp	95	2	MN551904.1
	Jaaginema sp	100	2	MN062657.1	Limnothrix planktonica	92	4	LT600739.1
	Anagnostidinema amphibium	100	1	MN128963.1

Figure 4. Phylogram constructed using 16S rDNA sequences from Ecuadorian cyanobacteria and similar sequences at the GenBank database. The phylogram was constructed using the maximum-likelihood method with Kimura 2 distance. Numerical values at the nodes of the branches indicate bootstrap values above 50%

Nübel U, Muyzer G, Garcia-pichel F, et al. PCR primers to amplify 16S rDNA genes from cyanobacteria PCR primers to amplify 16S rDNA genes from Cyanobacteria. Microbiology. 1997;63:3327–3332.

 Web of Science ®Google Scholar

Valério E, Chambel L, Paulino S, et al. Molecular identification, typing and traceability of cyanobacteria from freshwater reservoirs. Microbiology. 2009;155(2):642–656.

 PubMedGoogle Scholar

Visco JA, Apothéloz-Perret-Gentil L, Cordonier A, et al. Environmental monitoring: inferring the diatom index from next-generation sequencing data. Environ Sci Technol. 2015;49(13):7597–7605.

 PubMed Web of Science ®Google Scholar

Lee SR, Oak JH, Chung IK, et al. Effective molecular examination of eukaryotic plankton species diversity in environmental seawater using environmental PCR, PCR-RFLP, and sequencing. J Appl Phycol. 2010;22(6):699–707.

 Web of Science ®Google Scholar

Hadi SIIA, Santana H, Brunale PPM, et al. DNA barcoding green microalgae isolated from neotropical Inland waters. PLoS One. 2016;11(2):e0149284.

 PubMed Web of Science ®Google Scholar