Spoilage-related bacterial diversity of vacuum-packed plant-based meat as affected by essential oil and preservative

Figures & data

Figure 1. The sequencing process.

Table 1. Primer names and sequences.

Sequencing region	Primer name	Primer sequences
V3-V4	338F	ACTCCTACGGGAGGCAGCAG
	806R	GGACTACHVGGGTWTCTAAT

Table 2. Materials for PCR amplification^[19].

Materials	Dosage
5×FastPfu Buffer	4 μL
2.5 mM dNTPs	2 μL
Forward Primer(5 μM)	0.8 μL
Reverse Primer(5 μM)	0.8 μL
FastPfu Polymerase	0.4 μL
BSA	0.2 μL
Template DNA	10 ng
Add ddH2O to 20 μL

Figure 2. Core species curve.

Figure 3. Shannon dilution curve. C: CK group; J: composite essential oil (EO) group; K: composite preservative group.

Figure 4. Rank-abundance curve. C: CK group; J: composite essential oil (EO) group; K: composite preservative group.

Figure 5. Visualization of Alpha diversity indices. a. Sobs index; b. Simpson index; c. Shannon index; d. Chao index. *p<.05; ***p<.01.

Figure 6. Principal component analysis (PCA) of the different treatment groups.

Figure 7. Venn diagram for the different treatment groups.

Figure 8. Bar graphs of the bacterial abundance in the microbiota of the different groups. Relative abundance is indicated at the family level.

Figure 9. Pie charts showing the bacterial composition at the family level in the three groups. a, CK group; b, J group; c, K group.

Figure 10. Heat map of bacterial species abundance at the family level. The color gradient is represented on the right side of the figure.

Wang, G.; Xu, X.; Zhou, L.; Wang, C.; Yang, F. A Pilot-Scale Study on the Start-Up of Partial Nitrification-Anammox Process for Anaerobic Sludge Digester Liquor Treatment. Bioresource. Technol. 2017, 241, 181–189. DOI: 10.1016/j.biortech.2017.02.125.

 PubMed Web of Science ®Google Scholar

Data availability statement

The datasets generated for this study are available upon request from the corresponding author.’